Dinamiche della disinformazione

31

Uno studio pubblicato sulla rivista APS (Association for Psychological Science) illustra i meccanismi della disinformazione.

 

Ma sembra contemporaneamente voler influenzare i lettori riguardo al Global Warming…

 

Dello studio in questione se ne era parlato anche sul Corriere della Sera del 16 ottobre scorso nell’articolo Perché crediamo (fermamente) anche alle peggiori «bufale». Ma ancor più interessante è il sotto titolo: Le informazioni sbagliate continuano a influenzarci, spesso a dispetto di ogni smentita. Il dubbio si insinua a fatica”, una conclusione che rivela come sia difficile fare della controinformazione una volta che una determinata notizia sia stata messa in circolazione. Il meccanismo è confermato nell’incipit dell’articolo:

Vere o no che siano, le informazioni che ci raggiungono restano attaccate alle nostre menti, influenzando comportamenti e scelte. E anche quando ci rendiamo conto che il loro contenuto è falso, può risultare molto difficile riuscire a modificarle

A tali conclusioni è giunto uno studio pubblicato sulla rivista della Association for Psychological Science, sotto il titolo di Misinformation and Its Correction: Continued Influence and Successful Debiasing. Per prima cosa vengono individuate le fonti della possibile disinformazione:

Rumors and fiction. Societies have struggled with the misinformation-spreading effects of rumors for centuries, if not millennia; what is perhaps less obvious  is that even works of fiction can give rise to lasting  misconceptions of the facts.

Governments and politicians. Governments and politicians can be powerful sources of misinformation,  whether inadvertently or by design.

Vested interests. Corporate interests have a long and  well-documented history of seeking to influence  public debate by promulgating incorrect information. At least on some recent occasions, such systematic  campaigns have also been directed against corporate  interests, by nongovernmental interest groups.

The media. Though the media are by definition  seeking to inform the public, it is notable that they  are particularly prone to spreading misinformation  for systemic reasons that are worthy of analysis andexposure. With regard to new media, the Internet has placed immense quantities of information at our fingertips, but it has also contributed to the spread of  misinformation. The growing use of social networks  may foster the quick and wide dissemination of misinformation. The fractionation of the information  landscape by new media is an important contributor  to misinformation’s particular resilience to correction.

Nell’articolo si citano degli esempi di false notizie facendo riferimento al collegamento tra i vaccini e l’autismo e alla presunta nascita fuori dagli USA di Obama, tutte notizie che però, a differenza di quanto indicato nell’elenco, riguardano solo le dinamiche di Internet.

Nessun riferimento ai falsi diffusi dai telegiornali o dagli stessi governi o da altre fonti autorevoli, basti pensare alle armi di distruzione di massa di Saddam Houssein, o alla presunta pericolosità del virus H1N1, o alla bufala storica della credenza in una Terra piatta, su cose del genere, con una specie di autocensura, l’articolo non dice nulla.

Contrariamente a quanto viene fatto passare con gli esempi proposti, la più pericolosa fonte di disinformazione non possono essere che le fonti ufficiali, il ruolo del web è limitato dalla sua frammentazione e dal fatto di essere riservato inevitabilmente a delle nicchie.

Ma a questo punto un dato di questa ricerca suona sospetto: come esempio di disinformazione si riporta insistentemente la critica al Global Warming antropico, sul quale nel corso dell’articolo si ritorna con ben 23 citazioni. E così un articolo che dovrebbe spiegare i meccanismo della disinformazione, finisce col fare propaganda su una specifica questione definendo apoditticamente falsa una posizione riguardo al Global Warming.

E così, dopo aver fornito un esempio di una di quelle forme di disinformazione che vuole denunciare, l’articolo fornisce delle tattiche per difendersi dalla disinformazione:

 

 Sulla colonna di sinistra troviamo i problemi e su quelle di destra le soluzioni proposte:

Il primo suggerimento è quello di sostituire il racconto falso con uno alternativo.

Il secondo è quello di non ripetere il mito, porre l’enfasi sui fatti e iniziare a disporre delle barriere contro le strie false.

Il terzo è quello di elaborare poche e semplici risposte e iniziare a diffidare di certe fonti.

Il quarto è quello di non rigettare dei dati che mettono in dubbio la nostra visione del mondo, di affermare la propria identità e valori per accogliere meglio l’evidenza.

 

 Ma a ben vedere si tratta di indicazioni che potrebbero altrettanto bene difendere la verità o indifferentemente delle menzogne, le tecniche suggerite potrebbero benissimo essere impiegate per condizionare a non accogliere delle verità indesiderate.

Quello che manca in queste indicazioni è dunque la cosa più importante: come cercare e riconoscere le notizie false da quelle vere. E al riguardo un dato negativo viene dalla formazione scolastica (Scuola: uno spettro si aggira per l’Europa) che sempre meno sembra riuscire a dare gli strumenti necessari per il ragionamento e la ricerca della verità.

 Senza questa capacità, il resto non conta molto.

 

 

 

 

 

 

Share.

About Author

Laureato in Biologia e in Farmacia, docente di scienze naturali Nel 2011 ha pubblicato "Inchiesta sul darwinismo", nel 2016 "L'ultimo uomo" e nel 2020 "Il Quarto Dominio".

31 commenti

    • Ottimo esempio di macroevoluzione e speciazione tramite la selezione naturale.

      Grazie… 🙂

      • Giorgio Masiero on

        Io penso, southstar, che nessuno con un pizzico di sale possa mettere in dubbio il meccanismo della selezione naturale, soprattutto perché, a differenza della selezione artificiale “progettata” dagli allevatori a “fini” economici, la selezione naturale è… una tautologia.
        Qui però, come il clamore della scoperta fin dal titolo mostra, il problema con la semplicioneria neodarwiniana è l’estrema velocità dell’evoluzione che esclude in questa speciazione il gioco del caso nella pletora delle singole infinite mutazioni possibili (“it is unlikely that a complex suite of derived life-history characters including hermaphroditism, selfing and live-bearing could so quickly evolve via drift- and mutation-driven processes”) e sembra richiedere l’intervento d’un agente “fisico”. “In particular, our results are not consistent with the slow, gradual loss of shared alleles (and of reproductive compatibility) via genetic drift in allopatry (classic geographical speciation), or with divergent adaptation to broadly sympatric microhabitat differences such as different intertidal heights. […] Other alternative hypotheses, such as the evolution of these life-history traits as adaptations after divergence, or as correlated responses to selection on other traits, are not entirely consistent with our data”.
        E’ vero che i biologi, classicamente, dove non può il caso sembrano ricercare una spiegazione forzando l’intervento della selezione e dimenticandosi, secondo me, quello che hanno detto prima, ovvero che la selezione naturale agisce a posteriori e non può spiegare la velocità dei tempi, che postula invece una selezione a priori delle microevoluzioni utili alla speciazione finale. Però sono corretti almeno nel dire che le loro sono “ipotesi”, “speculazioni” la cui conferma “will require several types of new evidence”.
        A me sembra, invece, che senza negare il ruolo della contingenza, né quello della selezione naturale, nell’evoluzione delle specie, questo proceeding confermi il bisogno di andare “oltre” Darwin, ricercando un meccanismo fisico più profondo di preselezione delle microevoluzioni utili, per sottrarre le specie dalla roulette di Montecarlo e dar loro la possibilità di evolvere in tempi “astronomici” (centinaia di milioni di anni e anche meno) e non in tempi “impossibili” (10^(10^100) anni!).

          • Più che caso del “potere dell’evoluzione neodarwinana” ed esempio di “macroevoluzione ” tramite meccanismi biologici rappresenta una speciazione biologica o comunque in generale un processo microevolutivo che ha anche poco del neodarwiniano volendo.I ricercatori sono stati sorpresi di apprendere che divergevano gli uni dagli altri in modo rapido e recente.
            Ma comunque nient’altro che microevoluzione.
            Queste veramente belle e particolari stelle marine,molto simili in apparenza,vivono e sopravvivono come “specie” che non si incrociano.
            Se non erro,a differenza della sua sorella-sosia, Cryptasterina pentagona, C. hystera è un’ ermafrodita(o un ermafrodita?), in grado di evitare l’estinzione, anche quando la sua popolazione è scarsamente in grado di fecondarsi e mette al riparo larve all’interno del suo corpo,che si sviluppano. Questo sistema ha il potenziale svantaggio di ridurre la diversità genetica all’interno del pool genico della “popolazione”, ma può ,di contro parte,mantenere la popolazione in vita.Perciò avvenne che,limitando l’ingresso di altre “specie” di stelle marine al suo patrimonio genetico,la C.hystera ha affrettato un “isolamento genetico” e una speciazione …Cryptasterina pentagona e Cryptasterina hystera sono geneticamente simili,molto simili,decisamente simili,infatti sono un’unica specie,secondo alcune di quelle definizione che si vanno cacciando perchè non ben accette dalla “maggior parte di biologi & Co”…ma del resto se si vuole analizzare e valutare un fenomeno scarsamente si può avere vantaggio in una definizione che trova radici prima della scoperta del Dna o in altre che doipendono in toto dalla teoria neodarwiniana.. L’analisi del DNA nucleare e mitocondriale di queste due stelle marine suggerisce che queste due si sono discostate da una stella marina comune ancestrale(che chiameremo Cryptasterina archetipo) alcune migliaia di annoi fa… pur rimanendo comunque sia una certa incertezza legata al fatto di non poter in alcun mofdo determinare con una certa precisione il tasso di mutazione in passato per questa specie.
            Richard K. Grosberg, co-autore dello studio pubblicato nel Proceedings di luglio della Royal Society B. commentando la velocità della divergenza ,per esempio,ha riportato che per una simile divergenza sarebbero pochi anche 20000 anni..mostrandosi quindi fra l’incredulo e lo stupito nell’assistere ad un cambiamento così veloce.In verità però non è che vi sia niente di così sconcertante o drammatico se ricondotto alla giusta misura.
            Una di queste “specie”,varietà, C. pentagona, ha forme maschili e femminili, e si riproduce trasmettendo entrambi i gameti, maschili e femminili, in acqua dove avviene la fecondazione che galleggiano intorno in prossimità gli uni agli altri. C. hystera, invece, è un ermafrodita che si fertilizza e quindi mantiene le larve nel suo corpo fino a raggiungere l’età adulta.
            L’ipotesi dei ricercatori è che la stella marina ancestrale,l’archetipo C. si riproducesse in modo standard,tipico delle stelle marine,trasmettendo gameti in acqua. Questo metodo di riproduzione però come si evince richiede che le stelle marine ,maschio e la femmina,siano da qualche parte nella stessa zona affinchè il successo riproduttivo possa essere raggiunto. I ricercatori ipotizzano anche una diminuzione localizzata di densità di popolazione possa aver favorito la forma alternativa di riproduzione, ed il relativo isolamento delle ermafroditi consentì alle differenze di di concentrarsi finchè le varietà separate smisero di incrociarsi. Naturalmente, non c’è modo di sapere con certezza che questo sia accaduto, ma la ricerca recente ha dimostrato che la partenogenesi si presenta come una strategia riproduttiva per affrontare tali condizioni di questi animali(dualmente anche in rettili).
            In verità pertanto questa importante ricerca non da nulla di quello che viene riportato in diversi siti neodarwinisti.Infatti nessuna nuova informazione genetica valida per trasformarsi in un non-Cryptasterina è stata ottenuta o è stato possibile osservarla. In realtà,si dimostra una varietà di strategie riproduttive che vanno dalla riproduzione asessuata alla riproduzione sessuale utilizzando una strategia “broadcast” per la riproduzione sessuale con questi ermafroditi. Alcune varietà sono anche in grado di cambiare generi periodicamente, mantenendo così le fonti di entrambi i gameti maschili e femminili nella popolazione.Conclusione?Un caso di microevoluzione neodarwiniana.Niente che favorisca prova o valido elemento per pensare che possa avvenire in tempi anche lunghissimi una macroevoluzione verso altro che non sia una varietà di Cryptasterina.
            Non è certo questo che serve al neodarwinismo.
            Nessuno pensetrebbe che con cose “di questo genere” da scimmie australopitecine si possa arrivare all’uomo ,fra l’altro in un tempo anche di quanto?400 000-600 000 anni?
            Naturalmente tutti possono andare a valutare tutte le varie cose ed a trarne le ovvie conclusioni..
            Va da se che considerando come specie le specie biologiche e come evoluzione una modificazione con cambiamento,il fatto che qualsiasi cambiamento del DNA, che porti un qualche cambiamento, porta evoluzione, il neodarwinismo è certo una relatà,ma definendo un abitante delle favelas multimilionario non fa si che questi lo diventa o lo sia davvero.
            😀

          • “The speed of this speciation event suggests
            that it occurred via selection upon preexisting genetic variation on an ecological time scale, because it is unlikely that a complex suite of derived life-history characters including hermaphroditism, selfing and live-bearing could so quickly evolve via drift- and mutation-driven processes [9,63,64].”

            La variabilità era dunque preesistente

            Insomma la velocità si spiegherebbe perché la varietà su cui ha operato la selezione era preesistente: quindi niente nuovi caratteri.

            Come verrà ripetuto per il caso dell’E. coli, si tratta solo di riduzione di un patrimonio genetico inizialmente più ricco.
            Cioè, nel caso della stella di mare, di vera selezione.

            @Leonetto
            “Va da se che considerando come specie le specie biologiche e come evoluzione una modificazione con cambiamento,il fatto che qualsiasi cambiamento del DNA, che porti un qualche cambiamento, porta evoluzione, il neodarwinismo è certo una relatà,ma definendo un abitante delle favelas multimilionario non fa si che questi lo diventa o lo sia davvero”

            🙂

          • Leonetto scrive:
            21 ottobre 2012 alle 23:07

            “In verità pertanto questa importante ricerca non da nulla di quello che viene riportato in diversi siti neodarwinisti.Infatti nessuna nuova informazione genetica valida per trasformarsi in un non-Cryptasterina è stata ottenuta o è stato possibile osservarla.”

            Cryptasterina è la classifica del genere… Il genere Cryptasterina appunto. Come dovresti sapere la speciazione riguarda un evento di cambio specie NON di cambio di genere. Che richederebbe cambi ancora maggiori.

          • “Cryptasterina è la classifica del genere… Il genere Cryptasterina appunto. Come dovresti sapere la speciazione riguarda un evento di cambio specie NON di cambio di genere. Che richederebbe cambi ancora maggiori.”

            Si…appunto..ed è pressapoco quello il passaggio da corroborare che avvenga o,molto più comprensibilmente,che possa avvenire.
            Che secondo una o più classificazioni Cryptasterina classifichi il genere è chiaro ,ma non è corretto a seconda di cosa vogliamo osservare,studiare etc..
            Quello che va corroborato è la formazione di nuovi tipi di creature da altre pre-esistenti.
            Come detto se con specie intendiamo le specie biologiche non ha alcun senso per il problema di valutare una teoria che spiega la molteplicità dei viventi.
            Altrimenti è pura filosofia,puro credo dire che cambi maggiori e molto più tempo portino a grandi cambiamenti e a nuovi “generi” secondo alcune delle classificazioni che riporta.
            Quello che si vede in natura sono tanti tipi di animali(e piante)che si esprimono in più varietà,questo è valido oggi come è supponibile fosse valido prima.
            Così pertanto una Cryptasterina dovrà ,secondo il neodarwinismo,essere ottenuta attraverso una lunga trasformazione,un lungo processo che ha portato una non-Cryptasterina a divenire una Cryptasterina.
            Le variazioni che hanno portato a differenziarsi queste 2 varietà di Cryptasterina in quale modo potrebbero mai portare in n-mila anni ad una “nuova specie” che non sia più una Cryptasterina?
            Si postulerà sempre qualche varietà di Cryptasterina in questo modo senza nuova informazione(se non poi l’estinzione).
            Dove sta la nuova informazione?
            Oppure dobbiamo postulare l’esistenza di un ancestrale essere X contenente l’informazione di tutti i tipi di viventi che mano a mano ha dato origine ai vari tipi di organismi della Terra?
            Sono inutili sofismi quelli di considerare a tornaconto famiglia,genere,specie,sottospecie,varietà e compagnia bella,quelle sono classificazioni per catalogare,per ordinare e per potersene servire.
            A che serve una biblioteca con i libri alla rinfusa?
            Ma quello che appare in natura come già detto sono tipi di organismi dei quali soi possono trovare,si sono potute trovare o si troveranno tante e diverse varietà.
            Ma è la formazione di quei tipi che va corroborata.
            E quindi individuare una mutazione,una serie di mutazion, un processo evolutivo in cui si possa vedere un incremento di informazioni nel genoma.nuova informazione.
            Non rotture di meccanismi,informazione presa in prestito,ibridi,adattamenti vari etc..
            Queste cose non portano al di là della forma ne in tempi brevi ma nemmeno in tempi lunghi,certo lo si può credere ma non se ne ha ne esempio,ne prova ne corroborazione alcuna.
            Quello è.
            Ed è analogo il caso dell’E.Coli di Lenski.
            Ripeto quanto scritto sopra:
            “Non è certo questo che serve al neodarwinismo.
            Nessuno pensetrebbe che con cose “di questo genere” da scimmie australopitecine si possa arrivare all’uomo ,fra l’altro in un tempo anche di quanto?400 000-600 000 anni?”

            Credere ciecamente non è scienza.Che cose come quella che ha coinvolto la speciazione della Cryptasterina o come la selezione artificiale dell’E.Coli possano portare alla comparsa di nuove specie(non biologiche)con nuove funzioni è qualcosa che va creduto,non è possibile trovarne la minima conferma da questi esempi.
            Questa è la realtà dei fatti.

        • Inanzi tutto bisogna chiarire che un tempo definito non e richiesto per la teoria. Non è scritto da nessuna parte che una mutazione deve accadere entro X tempo e che deve portare ad una nuova specie entro Y. Quello che è richiesto è che le successive genereazioni si assomigliano cosi tanto fra di loro da essere considerate la stessa specie. Ed e solo dopo un tempo non definito che si potra vedere diferenze notevoli come nel nostro caso.

          Ecco ora che abbiamo sgombrato il campo da un concetto spesso poco conosciuto e confuso sulla TdE percui si pensa che l’evoluzione impiegi solo x millioni di anni.

          In questo caso citato, faccio notare che i ricercatori non dicono che quello che osservano non è consistente con la TdE.

          Given the low levels of genetic connectivity observed in both species, a range disjunction of 375 km represents a significant barrier to dispersal;
          therefore, the more parsimonious inference is that
          this speciation is the result of an extreme dispersal event, followed by geographical and reproductive isolation in conjunction with rapid adaptation to a new environment.

          Ecco qua identificano un classico passo l’isolamento delle e specie che insieme alla selezione naturale ha portato alla speciazione.

          Ora analizziamo i fatti:
          Abbiamo un evento di speciazione notevole, che puo solo essere considerato un evento macroevolutivo (usando le definizione corrente scientifica di macroevoluzione).
          Abbiamo tutti i fattori critici che indicano evoluzione: Specie fondatore, isolamento, selezione naturale e nuova specie.

          Ricordo a chiunque cerchi di chiamare questo evento (o altri)microevoluzione che deve per favore definire il termine. Dovrebbe indicare il limite superiore della microevoluzione (nelle specie) e spiegare come e perche questo caso non rientra nella microevoluzione nel contempo identificare essattamente quale mutazioni portano alla macroevoluzione. Per ultimo ricordo che se modificate le difinizioni dei termini dovete anche modificare gli stessi termini presenti nelle teorie. Finche questo non viene fatto i discorsi sul “è solo microevoluzione” non hanno alcun senso.

          • Giorgio Masiero on

            Non so, southstar, se la Sua risposta sia indirizzata anche a me. In quest’ultimo caso, vorrei dire:
            1) io non metto in dubbio la “teoria” dell’evoluzione: di fronte alle innumerevoli specie diverse, eppure via via simili, l’alternativa di pensare ad altrettante comparse ex nihilo o per abiogenesi, mi sembrerebbe una “teoria” assurdamente improbabile;
            2) io non ho discusso, in questo caso, della differenza tra micro- e macro-evoluzione, che cmq esiste ed è matematicamente rilevante ed irriducibile (se Lei è interessato a studiare sotto l’aspetto matematico l’argomento, La posso rinviare as articoli apparsi su riviste specializzate);
            3) ho scritto solo, e mi piacerebbe sapere se Lei è d’accordo con me, che la velocità eccezionale (secondo gli stessi redattori del paper) assunta dalla speciazione in questo caso, non si può ricondurre alla “selezione naturale” – che agisce “dopo” le micromutazioni in funzione di mantenerle o respingerle secondo la loro utilità marginale -, ma deve derivare da un meccanismo fisico “già” presente nella stella marina e agente “durante” la sua evoluzione, che in qualche modo la “incanalizza”, e sul quale la biologia molecolare è al momento totalmente muta.

          • Giorgio Masiero scrive:
            22 ottobre 2012 alle 12:40

            “1) io non metto in dubbio la “teoria” dell’evoluzione: di fronte alle innumerevoli specie diverse, eppure via via simili, l’alternativa di pensare ad altrettante comparse ex nihilo o per abiogenesi, mi sembrerebbe una “teoria” assurdamente improbabile;”

            Okay ma attenzione a non confondere le teorie del abiogenesi con la TdE. Sono molto distinte. Inoltre non sono a conoscienza di nessuna teoria del abiogenesi che postula la comprasa dal nulla.

            “2) io non ho discusso, in questo caso, della differenza tra micro- e macro-evoluzione, che cmq esiste ed è matematicamente rilevante ed irriducibile (se Lei è interessato a studiare sotto l’aspetto matematico l’argomento, La posso rinviare as articoli apparsi su riviste specializzate);”

            Sono pienamente d’accordo sul esistenza delle difinizioni nel ambito scientifico. Quello che trovo strano è la ridifinizione di tale termini. Per questo chiedo chiarezza, e che la “nuova” difinizione venga data. Inoltre se si ridifinsce il concetto bisogna apportare la stessa modifica alla teoria altrimenti ovviamente le due parti del equazione non sono piu in equilibrio.

            “3) ho scritto solo, e mi piacerebbe sapere se Lei è d’accordo con me, che la velocità eccezionale (secondo gli stessi redattori del paper) assunta dalla speciazione in questo caso, non si può ricondurre alla “selezione naturale” – che agisce “dopo” le micromutazioni in funzione di mantenerle o respingerle secondo la loro utilità marginale -, ma deve derivare da un meccanismo fisico “già” presente nella stella marina e agente “durante” la sua evoluzione, che in qualche modo la “incanalizza”, e sul quale la biologia molecolare è al momento totalmente muta.”

            La selezione naturale agische sempre, se tale mutazione non conferiva un elemento di fitness l’organismo sarebbe morto. Quindi non è mai possibile eliminare la selezione naturale dal sistema. Detto questo gli autori scrivono “The speed of this speciation event suggests that it occurred via selection upon preexisting genetic variation on an ecological time scale, because it is unlikely that a complex suite of derived life-history characters including hermaphroditism, selfing and live-bearing could so quickly evolve via drift- and mutation-driven processes [9,63,64]. The specific genetic targets of this selection are usually poorly known [65], but the evolution of the same suite of life-history traits in a northern temperate Cryptasterina species (and in other asterinid genera) suggests that the genetic variation needed for this adaptation may be widespread among cushion stars [25,31].

            Quindi tendono ad identificare che il materiale genetico e in parte gia presente nella specie precedente. Pero concludono dicendo “It is not known whether these similarities represent convergences (based on responses to selection at the same selected loci) or parallelisms (at different loci).” Quindi in sostanza non si sa, i ricercatori identificano poi dei futuri esperimenti per chiarire il punto.

            Concludo dicendo che cambiamenti del genre richiedono sempre mutazioni a livello genetico. Queste mutazioni, una volte selezionate e fissate, danno origine a nuove funzioni, o come in questo caso forse riabilitano funzioni pre-esistenti. Questo non cambia il fatto della diversità evidente delle due specie che è dopo tutto il fatto del evoluzione.

          • Leonetto scrive:
            22 ottobre 2012 alle 16:42

            “Così pertanto una Cryptasterina dovrà ,secondo il neodarwinismo,essere ottenuta attraverso una lunga trasformazione,un lungo processo che ha portato una non-Cryptasterina a divenire una Cryptasterina.
            Le variazioni che hanno portato a differenziarsi queste 2 varietà di Cryptasterina in quale modo potrebbero mai portare in n-mila anni ad una “nuova specie” che non sia più una Cryptasterina?
            Si postulerà sempre qualche varietà di Cryptasterina in questo modo senza nuova informazione(se non poi l’estinzione).”

            Dipende non hai ancora definito il limite di specie finche non lo farai non avara senso parlare di cambiamento di genere. Inoltre questo effetto e proprio previsto dalla TdE, che ci dice che ogni nuova generazione che nasce sara sostanzialmente uguale al genitore. Per questo non e probabile vedere una mutazione notevole come quelle che richiedi tu.

            “Dove sta la nuova informazione?”

            Ho notato che avete una fissazione su questa cosa…

            Ora mi dici quale delle due stringe ha piu informazioni:

            TGTGTTTAACGGAGCTGATTTCTT
            TAAGTTTAACGGAGCTGATTTCTT

            La sequenza 2 ha una sostanziale modifica che produce proteine diverse rispetto alla prima. Mi diresti quale delle due e quella del genitore?

            “Non è certo questo che serve al neodarwinismo.
            Nessuno pensetrebbe che con cose “di questo genere” da scimmie australopitecine si possa arrivare all’uomo ,fra l’altro in un tempo anche di quanto?400 000-600 000 anni?””

            Bhe in verita c’è una valanga di altre prove che
            attestano a questo. Un punto fondamentale pero e che scimmie sono ns cugine e nessun studio scientifico dira mai che l’uomo si e svilupato dalle scimmie.

            “Credere ciecamente non è scienza.Che cose come quella che ha coinvolto la speciazione della Cryptasterina o come la selezione artificiale dell’E.Coli possano portare alla comparsa di nuove specie(non biologiche)con nuove funzioni è qualcosa che va creduto,non è possibile trovarne la minima conferma da questi esempi.”

            Forse hai scritto male… hai detto selezione artificiale? in Lenski? Sul fatto di nuove funzione bhe non vi e dubbio, lo studio di Lenski lo dimostra e non è l’unico.

            Inoltre se dici che non ci sono nuove funzione mi dici come e stato possibile usare il citrato in condizioni aerobiche?

            Ultimo punto non credo ciecamente, ho una multitudine di ricerche sotto mano con tanto di dati. Tu cosa hai?

  1. Giorgio Masiero on

    @ southstar
    1. Col termine abiogenesi intendevo solo il significato etimologico di origine della vita dalla materia inanimata. Se non riteniamo possibile che la vita si sia originata dal nulla, né che le diverse specie si siano originate ciascuna improvvisamente dalla materia inanimata, l’evoluzione è l’unica base di partenza per cercare una spiegazione scientifica. Distinguo l’evoluzione dalle “teorie” oggi disponibili dell’evoluzione, considerando la prima certa (o almeno estremamente verosimile) e le seconde (dal darwinismo al creazionismo alla panspermia all’ID alieno) del tutto inaccettabili scientificamente.
    2. Sono d’accordo.
    3. Io sarei il primo a dichiararmi soddisfatto della sufficienza dei 2 fattori di caso e selezione naturale (il primo come motore del cambiamento ed il secondo come garante della stabilità delle forme viventi) per comprendere la ricchezza e la complessità delle specie dal pleuromona all’uomo, se il caso avesse avuto a disposizione un tempo infinito, o comunque estremamente superiore a quello fisico (di 10^10 anni). Ma, con questo Universo limitato in termini di spazio-tempo e di materia-energia, io non posso dal punto di vista scientifico accontentarmi di “aver vinto alla roulette di Montecarlo” (come si è accontentato Monod e si accontentano i neodarwinisti) e per giunta di avervi vinto 10^100 volte di seguito. Per questo cerco se, oltre alla contingenza e alla selezione naturale, il bricolage della vita non sia l’esito di leggi fisiche più profonde tutte da esplorare. E questo studio sulle stelle marine mi dà ulteriori motivi di credere che c’è “sotto” qualcosa di diverso da caso e selezione naturale a pre-selezionare le nuove forme d’ordine.

    • Giorgio Masiero scrive:
      23 ottobre 2012 alle 09:07

      “……se il caso avesse avuto a disposizione un tempo infinito, o comunque estremamente superiore a quello fisico (di 10^10 anni). Ma, con questo Universo limitato in termini di spazio-tempo e di materia-energia, io non posso dal punto di vista scientifico accontentarmi di “aver vinto alla roulette di Montecarlo” (come si è accontentato Monod e si accontentano i neodarwinisti) e per giunta di avervi vinto 10^100 volte di seguito.”

      Questo perche hai preso in considerazione una probabilità assoluta simili appunto alla roulette a montecarlo. L’errore sta proprio qui. Ricordati che ogni nuova generazione apporta delle modifiche al DNA e che queste modifiche vengono passate alla prossima generazione. Quindi non abbiamo un tiro di roulette ogni volta, ma un numero vicente ogni volta viene fissato e riportato al prossimo gioco.

      Un programma per mostrare questo punto lo puoi trovare qui:
      http://web.archive.org/web/200805141…tt/weasel.html

      Come puoi notare i passi per arrivare a modifiche sostanziali tramite l’accumulo di mutazioni e molto molto piu breve.

      “Per questo cerco se, oltre alla contingenza e alla selezione naturale, il bricolage della vita non sia l’esito di leggi fisiche più profonde tutte da esplorare.”

      Puo essere infatti questo aspetto mi intriga, pero quanto affermato fin ora direi che non e piu confutabile. Ho visto diverse ricerche serie che identificano nuovi meccanismi che trovo molto interessanti.

      “E questo studio sulle stelle marine mi dà ulteriori motivi di credere che c’è “sotto” qualcosa di diverso da caso e selezione naturale a pre-selezionare le nuove forme d’ordine.”

      Non penso proprio tanto piu che anche gli autori concordano sui meccanismi del evoluzione e in nessuna parte della ricerca si dichiara questo contradice l’evoluzione o e inspeigabile secondo la teoria attuale.

      • Giorgio Masiero on

        @ southstar
        1. “Può essere, infatti questo aspetto mi intriga, però quanto affermato finora direi che non è più confutabile”. Questo, southstar, che per Lei è un pregio, è proprio una delle caratteristiche per cui io ritengo il darwinismo (al pari, per es., della credenza in Dio) una speculazione non scientifica: la sua “non confutabilità”. Sono d’accordo con Lei: non esiste nessuna evidenza sperimentale possibile, nemmeno teoricamente immaginabile, che possa confutare il darwinismo. Questa proprietà non appartiene a nessuna teoria scientifica (della fisica, della chimica, ecc.) e, per Popper come per tutti gli epistemologi, se una teoria non è in nessun modo confutabile, non è scientifica. Essa è chiusa, perfetta, metafisica. A questo proposito ho dedicato un articolo nella sezione Tavola Alta.
        2. “Questo perché hai preso in considerazione una probabilità assoluta, simile appunto alla roulette di Montecarlo. L’errore sta proprio qui. Ricordati che ogni nuova generazione apporta delle modifiche al DNA e che queste modifiche vengono passate alla prossima generazione. Quindi non abbiamo un tiro di roulette ogni volta, ma un numero vincente ogni volta viene fissato e riportato al prossimo gioco”. Ma chi Le ha detto, southstar, che i miei calcoli non hanno tenuto conto delle modifiche positive applicate alla generazione successiva? Essi si applicano già al primo organismo monocellulare, anzi ad una sola proteina! Ed il mio richiamo virgolettato alla roulette di Montecarlo non è mio, ma di Monod e di tutti i darwinisti che si sono dedicati a calcolare la probabilità di sintesi anche di una proteina “semplice” come l’emoglobina! Il link che Lei mi ha inviato non dà accesso ad alcun file, ma se il programma è simile a quello suggerito da Dawkins in un suo libro, esso non è scientificamente accettabile perché teleologico, come ho dimostrato al link http://www.uccronline.it/2012/06/15/dove-neodarwinismo-coincide-con-creazionismo-il-bluff-della-selezione-naturale/

      • southstar scrive:

        “L’errore sta proprio qui. Ricordati che ogni nuova generazione apporta delle modifiche al DNA e che queste modifiche vengono passate alla prossima generazione. Quindi non abbiamo un tiro di roulette ogni volta, ma un numero vicente ogni volta viene fissato e riportato al prossimo gioco.

        Un programma per mostrare questo punto lo puoi trovare qui:
        http://web.archive.org/web/200805141…tt/weasel.html

        Come puoi notare i passi per arrivare a modifiche sostanziali tramite l’accumulo di mutazioni e molto molto piu breve.

        L’esempio riportato è stato da tempo confutato, tra gli altri da Giuseppe Sermonti, il motivo è presto detto.

        Se una scimmia dovesse battere casualmente a macchina la frase di Shakespeare “Methinks it is like a weasel” (“O forse somiglia a una donnola”), essendo la frase composta da 28 caratteri, ed essendo l’alfabeto inglese composto da 27 lettere, le possibili combinazioni di 27 lettere in una frase di 28 lettere (compresi gli spazi) sarebbero espresse da: 2728.
        A questo punto Dawkins inserisce un computer che “seleziona” frasi mutanti che più si avvicinino alla frase originale: “Il computer esamina le frasi mutanti nonsense, la “progenie” della frase originaria, e sceglie quella che, per quanto poco, assomiglia di più alla frase bersaglio…”
        Per poter completare la frase in un numero ragionevole di tentativi lo scienziato inglese introduce quella che definisce una “frase bersaglio” e un computer che conosce in anticipo la frase che deve essere composta, il che inserisce il finalismo nella teoria. L’unico modo per evitare il finalismo è quello di ammettere che le frasi debbano essere scelte mediante la selezione naturale, ma il fatto che le frasi intermedie siano dallo stesso Dawkins definite “nonsense” esclude che esse possano essere premiate dalla selezione naturale.
        Ecco la contraddizione di Dawkins: si parte da un “il processo cieco, inconscio, automatico” e per renderlo possibile nei dodici miliardi di anni dall’origine dell’universo si finisce per postulare un “computer” e una “frase bersaglio” che negano il processo cieco da cui si era partiti.

        Se questo ragionamento è uno di quelli su cui si basa la sua accettazione del neodarwinismo dovrebbe cominciare ad avere dei dubbi su tale teoria.

        • “L’esempio riportato è stato da tempo confutato, tra gli altri da Giuseppe Sermonti, il motivo è presto detto.”

          Domanda: ma hai letto la ricerca di Lenski?? 3 step mutation… “This three-step process—in
          which potentiation makes a trait possible, actualization makes the trait manifest, and refinement makes it effective—is probably typical of many new functions.” Mutazioni in tre fasi cumulative. Non sarebbe possibile arrivare ai Cit+ senza quest accumulo.

          Come se non bastasse Lenski un altro gruppo ha confermato esattamente gli stessi risultati.
          http://www.sciencedaily.com/releases/2012/10/121022145340.htm

          Quindi direi che possiamo tranquilamente chiudere il caso qui, almeno che hai sotto mano delle ricerche scientifiche che confutano Lenski e Näsvall. (Ma sappiamo entrambe che non le hai).

          Ultimo punto lo scopo del programma di Dawkins e solo quello di far vedere come il processo di accumulo di mutazioni permette di creare funzioni complesse in relativamente poco tempo. Guarda caso questo fu confermato da Lenski e altri gruppi.

          • Giorgio Masiero on

            @ southstar
            Se davvero, come Lei dice, “lo scopo del programma di Dawkins è solo quello di far vedere come il processo di accumulo di mutazioni permette di creare funzioni complesse in relativamente poco tempo. Guarda caso questo fu confermato da Lenski e altri gruppi”, io sono stato più bravo, southstar: io ho creato “programmi” ancora più efficienti, che ottenevano il risultato in ancor minor tempo! Il problema è, southstar, che tutti questi “programmi”, e tutti gli altri compresi gli ultimi da Lei citati, oltre a contenere variabili stocastiche, inseriscono fin dall’inizio stringhe obiettivo, “target”, che pre-selezionano il sotto-insieme delle mutazioni utili rispetto all’infinità di quelle possibili… D’altra parte, perché altrimenti Monod ebbe a dire che “abbiamo vinto alla roulette di Montecarlo”? perché Dawkins si è convertito alla panspermia, rinnegando il suo programma e le sue speculazioni sulle “molecole replicanti”?
            Che cos’è, southstar, quel target che tutti i programmatori alla ricerca di simulare l’evoluzione aggiungono al caso, per “canalizzarla”, se non la manifestazione di un driving field fisico sottostante?!
            L’astuzia del darwinismo di postulare il primo batterio (senza “prima” cercare di spiegarsi che cosa sia fisicamente e chimicamente la vita e come sia sorta sulla Terra) e pretendere nondimeno di spiegare scientificamente l’evoluzione delle specie è fondata sulla sabbia, perché è ragionevole (non Le pare?) che il meccanismo e il set di leggi fisiche che hanno assemblato atomi e molecole nel primo batterio, siano gli stessi che hanno successivamente fatto da motore all’evoluzione delle specie.
            Ci vediamo domani al convegno a Tor Vergata su Kaufmann?

          • Giorgio Masiero scrive:
            24 ottobre 2012 alle 14:28

            “Il problema è, southstar, che tutti questi “programmi”, e tutti gli altri compresi gli ultimi da Lei citati, oltre a contenere variabili stocastiche, inseriscono fin dall’inizio stringhe obiettivo, “target”, che pre-selezionano il sotto-insieme delle mutazioni utili rispetto all’infinità di quelle possibili…”

            Si viene inserita una stringa obiettivo ma solo in risposta ad un quesito specifico. Ad esempio alla domanda come ha fatto ad evolversi il CIT+ nei batteri di Lenski visto che la quantita di mutazioni necessarie è straordinaria e la probabilità che avvengono tutte insieme e assurdamente bassa. Nella domanda viene dato un target il CIT+. Cosi nel programma viene dato un target.

            In effetti pero nel evoluzione futura non abbiamo un target. Quindi, si questo è un limite del programma ma in sua difesa si puo dire che non rientra neanche nel suo scopo.

            “Che cos’è, southstar, quel target che tutti i programmatori alla ricerca di simulare l’evoluzione aggiungono al caso, per “canalizzarla”, se non la manifestazione di un driving field fisico sottostante?!”

            Scusa (non sono italiana) ma non ho ben capito la sua frase? Che target? driving field? what driving field?

            “L’astuzia del darwinismo di postulare il primo batterio (senza “prima” cercare di spiegarsi che cosa sia fisicamente e chimicamente la vita e come sia sorta sulla Terra) e pretendere nondimeno di spiegare scientificamente l’evoluzione delle specie è fondata sulla sabbia, perché è ragionevole (non Le pare?) che il meccanismo e il set di leggi fisiche che hanno assemblato atomi e molecole nel primo batterio, siano gli stessi che hanno successivamente fatto da motore all’evoluzione delle specie.”

            Non necessariamente no, cmq è un ottimo punto e fa riflettere…. Direi che un giorno sicuramente si avra un unione delle due teorie (abiogenesi e evoluzione) perche cmq sono sullo stesso continuum. Le forze chimiche/fisiche che hanno agito sulle prime proto cellule sono le stesse forze che agiscono oggi e possono essere studiate tranquillamente (qualora vengano identificate). Quindi in effetti non abbiamo bisogno di sapere come si è formata la vita. Come non abbiamo bisogno dei dati genetici dei nonni o genitori per analizzare il genoma di un bimbo.

            Inoltre leggendo le varie ricerche sul abiogenesi tutte postulano ambienti e condizioni differenti dalle attuali. I processi che portarono alla prima vità probabilmente non agiscono oggi. O se agiscono non lo sappiamo. Il campo e troppo nuovo anche se ho visto che la quantità di ricerca e in aumento. (Panspermia la considero ininfluente perche non fa che spostare il problema altrove).

            “Ci vediamo domani al convegno a Tor Vergata su Kaufmann?”

            Ehm no sono ben distante.

          • Giorgio Masiero on

            Peccato, mi sarebbe piaciuto incontrarLa per approfondire la discussione a voce. Comunque, Lei parla bene l’italiano!

          • stò cò frati e zappo l'orto on

            Prof.Masiero è presumibile che sia del tutto interessante un dibattito con questa signora espertissima di evoluzionismo.Possibilmente su questa bellissima Tribuna.Non tutti gli spettatoridel blog possono trasferirsi al Convegno di Roma.

          • Per comprendere bene i problemi del neodarwinismo è necessario conoscere un po’ di teoria dell’informazione(beh in verità si potrebbero capire bene anche senza ,ma fa sicuramente decisamente comodo,specialmente circa certe tematiche)
            Ora, al di la proprio del neodarwinismo,certe cose non si possono comunque accettare né sentire a prescindere.E’ perciò necessario aprire una parentesi sull’esempio offerto da Dawkins..
            Un target o obiettivo è quello che bisogna raggiungere,se viene raggiunto avremo una buona coclusione,altrimenti no..
            Non è tanto il problema di postulare e definire un target er semplificare o per necessità pratiche…
            Il problema è definire la regola che fa si che si formi quel target(che si formerà per forza sempre in ogni caso prima o dopo)(dire in buona sostanza se il primo carattere è M mantienilo e non controllare più atrimenti ricontrolla e poi eseguire lo stesso su ogni carattere fino al raggiungimento della frase) senza giustificarla minimamente e far finta che il tutto si verifichi casualmente.
            Quindi alla fine dei giochi (io questo già avevo avuto occasione di dirlo),o si è dimostrato che un finalismo e un progetto portano ad una desiderata conclusione(ed è un’ovvietà) oppure si dice qualcosa che suona come:”se le cose fossero andate così sarebbe finita così”,che equivale al nulla…
            In ogni caso quindi quell’esempio è cretino,scusate il francesismo, ma non credo possa esistere qualche termine migliore per definirlo.
            Ma difenderlo è ancora peggio che proporlo eh…molto peggio..
            Ricordo ,come già detto,che l’informazione si può definire come quell’ elemento che opera un ordinamento di simboli o cifre in modo da dare ad essi un significato compiuto e si misura in bit.
            Non esiste prova alcuna che si ottenga informazione dal caso(caso necessità e contingenza) oppure nuova informazione qualora ne esista già qualcuna.(certo se si va a cinsiderare nuovo qualcosa che esiste già e che è variato in modo da migliorare il suo rendimento in qualche misura, oppure qualcosa che viene ottenuto da qualcosa che già ce l’ha o cose del genere per forza che poi si fa confusione..)
            Quello che pretendeva di provare la simulazione non solo non la prova,ma è proprio sbagliato nelle fondamenta!
            Condivido invece (mi può star bene più che altro,l’ho già detto in altre occasioni)invece il fatto che ciò che possa aver dato origine alla vita possa non avere a che fare con quello che eventualmente l’ha fatta evolvere nelle varie forme.Resta ad ogni modo un problema.

          • stò cò frati e zappo l’orto scrive:
            24 ottobre 2012 alle 20:57

            “Prof.Masiero è presumibile che sia del tutto interessante un dibattito con questa signora espertissima di evoluzionismo.Possibilmente su questa bellissima Tribuna.Non tutti gli spettatoridel blog possono trasferirsi al Convegno di Roma.”

            Purtroppo non sono espertissima in materia ed e anche uno dei fattori che mi interessa di questo blog: rispondendo e spiegando il corretto funzionamento insieme alle prove che stanno dietro alla teoria imparo di piu. Inoltre secondo me questo genere di dibattito e meglio fatto su un blog perche cosi si ha il tempo materiale di reperire e studiare le prove a sostegno.

          • stò cò frati e zappo l'orto on

            La ringrazio dell’onore e della sua modestia.

            Se mi permette lei è molto informata,quanto mai segue con passione un tema fondamentale,sia per i ricercatori,per gli appassionati e per tutti “gli spettatori”.

            E’ quasi indispensabile un civile confronto.

            Debbo anche dire che come tutti sono un sostenitore
            “del chiarirsi le idee”.

            Terminando dovrei dire che è propio Internet il luogo ideale(magari anche un pò di Tv,non guasterebbe)per esporre le propie tesi.

          • Leonetto scrive:
            25 ottobre 2012 alle 07:26

            “Per comprendere bene i problemi del neodarwinismo è necessario conoscere un po’ di teoria dell’informazione(beh in verità si potrebbero capire bene anche senza ,ma fa sicuramente decisamente comodo,specialmente circa certe tematiche)”

            No la teoria del informazione è totalmente inutile nel comprendere qualsiasi cosa riguardo l’evoluzione.

            Perche? Semplice non si puo usare (vedi i miei esempi di nucleotidi mutati che nessuno è in grado di risolvere) e la misura di informazioni come quantità assoluta non ci dice nulla (vedi l’esempio del genoma della cipolla). Quindi cosa ti rimane, non siamo in grado di misurare modifiche di informazioni e non siamo in grado di dare significati a quantità di informazioni. Ora dimmi pure a cosa serve secondo lei.

            “Non esiste prova alcuna che si ottenga informazione dal caso(caso necessità e contingenza) oppure nuova informazione qualora ne esista già qualcuna.”

            Ah no? Fai questo esperimento, ti servira un barattolo di vetro, acqua, sabbia fine e sabbia grossa. Riempiere il barattolo di acqua, ora prendere una manciata di sabbia fine e mescola bene con sabbia grossa in modo che i grani sono mischiati fra loro a caso. Ora getta la miscela di sabbia nel barattolo. Il giorno dopo osservi cosa e successo. La sabbia grossa si è posizionata in basso e quella fine in alto. Da un sistema caotico random hai un sistema ordinato da cui è possibile ottenere nuove informazioni specifiche.

            Quanto alla simulazione lo scopo dichiarato e molto semplice. “The aim is to demonstrate that the process that drives evolutionary systems — random variation combined with non-random cumulative selection — is different from pure chance.” Ora si senta libero di provare il contrario. Ricordo anche che i studi di Lenski (e non solo) hanno dimostrato l’importanza di mutazioni cumulative nel evoluzione.

  2. Ritornando alle tecniche di disinformazione e alla difficoltà di sradicare le idee inculcate precedentemente nella mente dalla cultura dominante, volevo dire che hanno ragione nel descrivere i meccanismi mentali dietro questa difficoltà.

    Del resto sono esattamente i meccanismi usati dalla propaganda su qualunque tema che hanno permesso di sradicare le idee (vere) precedenti nella massa della popolazione. Pochi hanno senso critico sufficiente per
    non farsi condizionare da questi meccanismi psicologici. E anche lì, si crede di non essere influenzati, ma qualcosa rode sempre o anche inconsciamente indebolisce le convinzioni.

    Del resto un cambio di paradigma non viene mai effettuato da loro prima di averne uno nuovo più completo, anche se il vecchio comincia a fare troppa acqua. Il motivo è che la gente ha bisogno di riempire i ‘gap’, anche emozionalmente, come dice il primo punto delle soluzioni proposte.

    Non c’è solo la parte razionale, dobbiamo tenere conto del lobo destro emotivo e delle emozioni che influenzano così tanto la nostra vita.

    Quindi, ho letto nel blog che sostenete di dover difendere le critiche all’evoluzionismo a prescindere dall’affermazione di una teoria alternativa. (credo a proposito della recensione di CR sul libro del prof. Pennetta).

    E’ senz’altro corretto da un punto di vista ‘razionale’. Ma non lo è da quello ‘emotivo’.
    Magari sarebbe meglio organizzare una risposta più completa, con una parziale soluzione alternativa al problema per dare una rassicurazione maggiore a chi si trova a cambiare idea su argomenti così incisivi e importanti.

    Tipo sulla falsariga dell’Intelligent design (non il creazionismo biblico letterale).

    Insomma, usiamo -e impariamo- anche noi le tecniche così efficaci che i nostri avversari usano nel condizionare le menti. Avremo anche noi più successo.

    • Buonasera frank,
      anche in questo caso concordo con lei.
      Pur restando nella convinzione che la pars destruens debba essere razionalmente sufficiente a far abbandonare una ipotesi, una pars construens deve in ogni caso seguire, non solo come conseguente ricerca scientifica di chi ha abbandonato la teoria falsificata, ma anche per le motivazioni di ordine psicologico da lei addotte.

      Ed è per questa ricerca di un’alternativa che è stata avviata l’iniziativa della Tavola Alta.
      Sono comunque dell’idea che un’opera di debunking, quando i fatti sono così evidenti, possa avere un apprezzabile successo anche in presenza di un forte disparità di forze.