Escherichia Coli: è vera evoluzione? (prima parte)

25

 

Un articolo pubblicato su Nature il 19 settembre scorso sembra confermare l’avvenuta evoluzione del batterio E. Coli.

 

 

Ma è veramente così?

 

 “Genomic analysis of a keyinnovationin an experimental Escherichia coli population“, così si intitola lo studio condotto da Zachary D. Blount, Jeffrey E. Barrick, Carla J. Davidson e Richard E. Lenski, pubblicato su Nature lo scorso settembre.

Riassumendo la vicenda,  in un esperimento condotto da R. E. Lenski sul batterio Escherichia coli si scoprì che esso aveva sviluppato la capacità di utilizzare il citrato presente nel terreno di coltura in presenza di ossigeno, mentre normalmente l’E. coli è in grado di utilizzare il citrato presente solo in assenza di ossigeno.

L’argomento è tutt’altro che nuovo ed era stato già affrontato su CS-Quel che Lenski non ha detto… (storia di una mancata evoluzione), un articolo nel quale si evidenziava proprio il fatto che fondamentalmente la capacità di metabolizzare il citrato disponibile nell’ambiente era già presente nel batterio, ma che era attiva solo in assenza di ossigeno, il motivo è che in presenza di ossigeno il citrato viene già ottenuto per via metabolica ed è quindi del tutto inutile utilizzare quello presente nell’ambiente.

La capacità di utilizzare il citrato in presenza di ossigeno corrisponde quindi alla “rottura” di un meccanismo vantaggioso per l’E. coli, un meccanismo che gli consente di risparmiare energia. Volendo fare un paragone, è come se per illuminare una strada ci fossero dei lampioni che però di giorno vengono spenti per mezzo di una fotocellula. Il batterio geneticamente modificato di Lenski corrisponde esattamente a quella strada nel caso in cui i lampioni restino accesi anche con la luce solare.

 In questo caso emerge una prima difficoltà a definire “evoluzione” il guasto di un meccanismo che è invece un efficacissimo dispositivo di ottimizzazione metabolica.

 Secondo l’evoluzionismo neo-darwiniano, comunque, qualsiasi cambiamento è “evoluzione”, affermazione questa  che viene qui ritenuta inadeguata e fuorviante, in particolare quello che si contesta è che un caso come questo non mostra la comparsa di una nuova funzione ma la soppressione di una funzione precedentemente attiva. Evidentemente non si può pensare che si sia passati, da un organismo unicellulare ai mammiferi solo per “sottrazione”, cioè per eliminazione di funzioni, questo porterebbe infatti alla conclusione paradossale che il primo organismo, da cui gli altri discendono, conteneva tutte le informazioni e che poi si sarebbe “evoluto” eliminando ora l’una ora l’altra… paradossale, appunto.

 Ma per giungere a queste conclusioni non è necessario essere degli specialisti, basterebbe essere dei semplici studenti liceali, vediamo infatti cosa dice un libro da III liceo scientifico sul metabolismo dell’ E. coli:

Ricordiamo che nel caso del citrato si tratta di un sottoprodotto del ciclo di Krebs, e come si può leggere, la capacità di non sintetizzare, o come in questo di non assorbire, una risorsa già disponibile è una strategia di risparmio energetico.

Nell’E. coli sono dunque presenti meccanismi per attivare una funzione quando necessaria e altri per sospenderla quando non è necessaria, due esempi, sempre riportati sul testo, sono quelli dell’attivazione degli enzimi per utilizzare il lattosio quando è disponibile, e l’esempio del meccanismo per il blocco della produzione del triptofano quando questo è presente nell’ambiente:

Nella figura a sinistra la presenza del lattosio sblocca il repressore legato all’operatore  rendendo possibile la produzione dell’enzima per l’utilizzazione del lattosio stesso.

Nella figura a destra invece la presenza di triptofano attiva il repressore che blocca l’operatore, inibendo così la produzione dell’enzima per la produzione del triptofano.

Come si legge inoltre nella didascalia, viene presentata la possibilità che una mutazione impedisca ad un repressore di legarsi all’operatore e consentire quindi una funzione che dovrebbe essere invece inibita.

 Dal punto di vista funzionale (anche se in modo più articolato) il caso ipotizzato nella didascalia è proprio quanto avviene nell’esperimento di Lenski, ma nessuno sul manuale di liceo pensa che questo fatto possa essere riportato come un esempio di evoluzione, perché allora dovrebbe essere considerata tale la stessa eventualità quando si è verificata nell’esperimento di Lenski?

 

Quale che sia stato il meccanismo seguito, siamo in presenza di una perdita di funzione, non dell’acquisto di una nuova funzione, ma l’evoluzione dei viventi deve essere avvenuta per acquisizione di nuove funzioni.

Da questo punto di vista la mutazione dei batteri di Lenski non porta quindi nessun contributo alla spiegazione dell’origine delle specie.

 

 

 

Share.

About Author

Laureato in Biologia e in Farmacia, docente di scienze naturali Nel 2016 ha pubblicato "L'Ultimo uomo" . .

25 commenti

  1. faccio un osservazione da profano: la perdita o l’acquisizione di una funzione rende il batterio diverso da prima, come si fa a decidere se tale diversità fa avanzare o regredire l’essere nell’evoluzione?

    Non basta che sia diverso da prima per parlare di evoluzione?

    Forse anche la perdita di una funzione può essere vista come un miglioramento, un più?

    Oppure per parlare di evoluzione è necessaria la comparsa di nuove funzioni prima inesistenti?

    Grazie

    • Ti rispondo (per il momento io) da profano: allora vorrebbe dire che l’organismo primordiale da cui tutti gli altri si sono evoluti avrebbe dovuto avere TUTTE le funzioni dell’universo (comprese quelle dell’uomo moderno), come dice efficacemente il prof. Pennetta nell’altro articolo.

      • Però pensavo che se perdere una funzione diventa un vantaggio è un miglioramento, la perdita di questa funzione potrebbe essere un adattamento parziale di una funzione precedentemente acquisita?

        Cioè l’affinamento di altre funzioni acquisite?

        grazie

        • Infatti per l’evoluzione la perdita o guadagni di funzioni è irrilevante. Conta solo il grado di fitness rispetto al ambiente.

          Inoltre che siamo davanti ad una perdita o una mutazione alla pari o un guadagno siamo cmq davanti ad un organismo non piu uguale a quello precedente con funzioni diverse. Un esempio clamoroso riguarda i denti nelle galline. Questa funzione è stata persa da un po di tempo ma nessuno si lamenta della disastorza perdita di informazioni.
          http://www.scientificamerican.com/article.cfm?id=mutant-chicken-grows-alli

          • La corroborazione della teoria neodarwiniana non può venire da un caso in cui si certifica una perdita di funzione, anche se questo dovesse comportare un aumento di fitness in un determinato ambiente (che comunque per puntualizzare in questo caso è artificiale).

            Infatti, a meno che non si voglia ammettere una fantasiosa ipotesi di una cellula primordiale con il massimo di informazioni (come ha ben compreso Piero), una specie di “cellula di Dio” per prafrasare il Bosone di Higgs, dobbiamo cercare come nascano le nuove informazioni, non come si cancellano quelle esistenti.

            Per usare una frase recentissima di Werner Arber:
            “the widely studied E. coli bacterium corresponds to the information content of the Bible. By contrast, the genetic information of multicellular plants and animals often corresponds to an encyclopedia of 100 up to 1000 volumes of the size of the Bible. The human genome corresponds to about 700 such volumes.”

            La quantità di informazioni necessarie a passare da E. coli all’uomo è di circa 700 volte superiore e la teoria dell’evoluzione deve rendere conto di questo.

            L’esperimento di Lenski andrebbe bene, come detto sopra, se dovessimo giustificare invece il passaggio dall’uomo a E. coli.

          • Enzo Pennetta scrive:
            22 ottobre 2012 alle 12:44

            “La corroborazione della teoria neodarwiniana non può venire da un caso in cui si certifica una perdita di funzione, anche se questo dovesse comportare un aumento di fitness in un determinato ambiente (che comunque per puntualizzare in questo caso è artificiale).”

            Solo in termini assoluti, in termini di time frame piu corti si puo tranquillamente accettare perdita di funzioni solo se accompagnati da un incremento del fitness del organismo. L’evoluzione non ha una direzione.

          • Quindi vale per la microevoluzione (sulla quale siamo tutti d’accordo), la macroevoluzione necessita di un incremento di funzioni, ma qui non se ne vedono di nuove.

          • Enzo Pennetta scrive:
            22 ottobre 2012 alle 14:13

            “Quindi vale per la microevoluzione (sulla quale siamo tutti d’accordo), la macroevoluzione necessita di un incremento di funzioni, ma qui non se ne vedono di nuove.”

            Bene alora direi che siamo tranquilamente nel ambito di macroevoluzione.

            Cito la ricerca”The evolution of the Cit1 trait involved three successive processes: potentiation, actualization and refinement… The new function
            was then refined, which allowed the efficient exploitation of citrate, the rise of the Cit1 subpopulation to numerical dominance,
            and the expansion of the total population size.”

            New function…

            Cito Lenski “It wasn’t a typical mutation at all, where just one base-pair, one letter, in the genome is changed,” he said. “Instead, part of the genome was copied so that two chunks of DNA were stitched together in a new way. One chunk encoded a protein to get citrate into the cell, and the other chunk caused that protein to be expressed.”

            Ancora Lenski sottolinea che abbiamo un nuova funzione che crea una nuova proteina e un altra che la attua. In verità non siamo davanti ad una nuova funzione ma almeno 2.

            Se ritieni che queste funzioni erano gia esistenti puo tranquilamente indicare il loco preciso della sequenza genomica in un e.colli proveniente dalle altre colonie oppure anche nella colonia Ara-3 prima della generazione 20.000.

          • ma scusa… ma ci sono specie con i denti?

            Quindi ogni specie successiva deve avere necessariamente meno funzioni di quella precedente?
            Per quanto io sia profano, mi sembra che questa, invece che evoluzione, sia piu’ una involuzione!!!

          • Piero scrive:
            22 ottobre 2012 alle 16:44

            “ma scusa… ma ci sono specie con i denti”

            No ma il gene che codifica per i denti è ancora presente, un superstite dai tempi in cui effetivamente gli uccelli avevano denti ma erano (gli Odontornithes) al tempo dei dinosauri.

            “Quindi ogni specie successiva deve avere necessariamente meno funzioni di quella precedente?”

            Mentre questa particolarita potrebbe essere vista come una perdita di funzione e accorporata a molti altri guadagni di funzioni tipo la creazione di un piumaggio piu complesso rispetto ai antenati. In sostanza non vi e neccessità per l’evoluzione di avere guadagno o perdita di funzioni. Anche se una perdita prolungata globale non favorisce l’evoluzioni. Un alternanza fra periodi di guadagno netti e perdite nette e del tutto possibile.

            “Per quanto io sia profano, mi sembra che questa, invece che evoluzione, sia piu’ una involuzione!!!”

            E importante sapere che l’evoluzione non ha in alcun modo una direzione. Pensa al evoluzione dei cetacei – transazione dalla terra al mare con predita di arti (anche se sono ancora presenti in forma di scheletro). Inoltre l’organismo va sempre paragonato al suo ambiente. Il fitness è cio che determina la sua capacità di sopravivenza. Noterai che infatti quelli piu adatti tendono a sopravivere e a rafinare le proprie abilità. Il che vuole dire che se cambia l’ambiente la perdita di una funzione in effetti da un guadagno (vantaggio) di fitness ed è questo quello che conta.

  2. “La capacità di utilizzare il citrato in presenza di ossigeno corrisponde quindi alla “rottura” di un meccanismo vantaggioso per l’E. coli, un meccanismo che gli consente di risparmiare energia.”

    Questa argomentazione mi sembra un po deviata visto che l’effetto finale non è per niente negativo sul organismo e anzi da abilità ad attingere ad una nuova fonte di energia. Se mai è proprio l’opposto ora l’organismo ha due fonti di energia disponibili!

    “In questo caso emerge una prima difficoltà a definire “evoluzione” il guasto di un meccanismo che è invece un efficacissimo dispositivo di ottimizzazione metabolica.”

    Nessuno penso dubità l’aumento del fitness della popolazione di Ara-3 rispetto alle altre popolazioni quindi quale guasto vedi? Puoi indicare la sequenza genetica che corrisponde al guasto e idicare come sia dannosa per l’organismo?

    “Secondo l’evoluzionismo neo-darwiniano, comunque, qualsiasi cambiamento è “evoluzione”, affermazione questa che viene qui ritenuta inadeguata e fuorviante, in particolare quello che si contesta è che un caso come questo non mostra la comparsa di una nuova funzione ma la soppressione di una funzione precedentemente attiva.”

    Si? quale funzione è stata ripressa sospesa?
    La nuova funzione è appunto l’abilita di assorbire citrato in condizioni arobiche (funzione che non è presente in nessun altra delle 11 colonie e neanche in nessun e.colli) e che e collegata all produzione di una proteina nuova (mai esistita prima nella specie). Questa nuova funzione è stata possibile grazie a mutazioni avenute in tre fase distinte.

    “Dal punto di vista funzionale (anche se in modo più articolato) il caso ipotizzato nella didascalia è proprio quanto avviene nell’esperimento di Lenski, ma nessuno sul manale di liceo pensa che questo fatto possa essere riportato come un esempio di evoluzione, perché allora dovrebbe essere considerata tale la stessa eventualità quando si è verificata nell’esperimento di Lenski?”

    No, non è per niente quello che accade nel espermineto di Lenski, altrimenti il “playback” avrebbe dato chiari risultati di mutamenti collegati a questo fattore. Invece prima della generazione 20.000 tutte le linee non hanno la possibilita di evolvere questa nuova funzione. Ricordo che anche nelle altre 11 colonie questo non e avvenuto). Appunto ci è voluto un specifico mutamento preparatorio. L’analisi genomica inoltre sottolinea come siamo davanti ad un mutamento sostanziale del genoma. Con duplicazioni genetiche e consegnuente mutazioni di certe parti del genoma. Si considera questo un caso di evoluzione proprio per le tre fasi distinte nel tempo e per la capacità nuove che si sono evolute.

    “Quale che sia stato il meccanismo seguito, siamo in presenza di una perdita di funzione, non dell’acquisto di una nuova funzione, ma l’evoluzione dei viventi deve essere avvenuta per acquisizione di nuove funzioni.”

    Ancora non identifica quale siano le funzioni perse. Quale parte del genoma è andato perso?

    Concludo con citare la ricerca stessa “This three-step process—in which potentiation makes a trait possible, actualization makes the trait manifest, and refinement makes it effective—is probably typical of many new functions.”

    • Come ho già detto non è che l’organismo adesso ha due fonti disponibili, il citrato poteva usarlo anche prima, ma solo quando non lo ricavava dal ciclo di Krebs.
      Per restare nel paragone, allora i lampioni accesi anche di giorno sarebbero un vantaggio… diciamolo al sindaco così magari provvede.

      Il guasto è individuabile nell’aggiramento di un blocco, in qualunque modo esso sia avvenuto, la sequenza genetica coinvolta non ha importanza quale sia.
      Il fatto è che una funzione di blocco c’era e adesso non c’è più.

      Sul resto risponderò nella seconda parte.

      • Enzo Pennetta scrive:
        22 ottobre 2012 alle 12:54

        “Come ho già detto non è che l’organismo adesso ha due fonti disponibili, il citrato poteva usarlo anche prima, ma solo quando non lo ricavava dal ciclo di Krebs.
        Per restare nel paragone, allora i lampioni accesi anche di giorno sarebbero un vantaggio… diciamolo al sindaco così magari provvede.”

        L’organsimo non aveva il meccanismo per usare il citrato – mancava proprio! Cito la ricerca stessa “This amplification is not present in the ancestor or any of the sequenced Cit– genomes, and it is only found in population samples after the evolution of the Cit1 lineage” Penso che il punto sia chiaro. Il suo paragone non regge al evidenza dei fatti riportati nella ricerca. Se vogliamo usare la sua analogia e come se ci fossero due lampioni ma l’interuttore di uno dei lampioni era fuori portata e serviva una scala per accederci. L’evoluzione forni una scala che non era presente prima.

        “Il guasto è individuabile nell’aggiramento di un blocco, in qualunque modo esso sia avvenuto, la sequenza genetica coinvolta non ha importanza quale sia.
        Il fatto è che una funzione di blocco c’era e adesso non c’è più.”

        La ricerca e i dati supplementary non indicano in nessuna parte “il blocco” a cui lei si riferiesce. Puo essere piu preciso nel definire l’esatta posizione nel genoma e composizione di questo blocco? Potresti indicare l’esistenza genomica del blocco nel genoma delle altre colonie?

        Sembra pensare che questa mutazione è avenuta per via di una rimozione, questo viene chiaramente contradetto dalla ricerca in cui viene identificato con precisione il sistema di mutamento e non ha nulla a che fare con “una rimozione” o neanche “un blocco”.

        • Le parole hanno un significato preciso:
          “L’organsimo non aveva il meccanismo per usare il citrato – mancava proprio! Cito la ricerca stessa “This amplification is not present in the ancestor or any of the sequenced Cit– genomes, and it is only found in population samples after the evolution of the Cit1 lineage””

          Quello che mancava era l’amplificazione, non il meccanismo per usare il citrato… questa obiezione mi sorprende.

          Il blocco è nel repressore attivo nelle cellule non mutate, restando nel paragone è come se fosse stato messo un secondo lampione, copia del primo, ma senza interruttore, in questo sta l’ “aggiramento” del blocco.

          E la duplicazione di una parte preesistente di genoma è un tipo di mutazione che non giustifica affatto la storia evolutiva della Terra.
          Non saremo mica tutti dei frattali di un’unica sequenza nucleotidica?

          • “Quello che mancava era l’amplificazione, non il meccanismo per usare il citrato… questa obiezione mi sorprende.”

            La mutazione di amplificazione è neccessaria per il funzionamento del sistema. Senza amplificazione non funziona. Cito la ricerca “Amplification mutations can alter the spatial relationship between structural genes and regulatory elements, potentially causing altered regulation and novel traits”.
            Inoltre come descritto nello studio L’amplificazione e solo una piccola parte della serie di mutazioni necessarie. “We tested whether
            the rnk-citT module confers a Cit1 phenotype by inserting a single copy of an amplification fragment containing the rnk promoter
            immediately upstream of the chromosomal copy of citT (Fig. 4a) in potentiated clone ZDB30. This construct, ZDB595, indeed has a Cit1
            phenotype, although it is extremely weak, similar to the earliest evolved Cit1 variants”

            Ricordo come evidenziato dalla ricerca non si tratta di una mutazione una tantum semplice. Ma di molte mutazioni in diversi fase.

            “Il blocco è nel repressore attivo nelle cellule non mutate, restando nel paragone è come se fosse stato messo un secondo lampione, copia del primo, ma senza interruttore, in questo sta l’ “aggiramento” del blocco.”

            Non esiste nessun “repressore attivo” evidenziato dalla ricerca. Sono curiosa in che parte del genoma vede questo meccanismo, puo essere un po piu specifico ed identificare il loco e l’esatta sequenza genetica a cui si riferisce?

            “E la duplicazione di una parte preesistente di genoma è un tipo di mutazione che non giustifica affatto la storia evolutiva della Terra.”

            Duplicazione genetica fornisce materia che puo mutare. Come puo apprendere anche dalla ricerca “Comparative studies have shown that gene duplications have an important creative role in evolution by generating redundancies that allow neo-functionalization”
            Inoltre la invito ad informarsi leggendo le seguenti ricerche riguardo la duplicazione genetica che non lasciano dubbi:
            http://scholar.google.it/scholar?hl=it&q=evolution+gene+duplication&btnG=&lr=
            Come puo vedere la dupplicazione genetica è una delle vie tramite cui opera l’evoluzione con molti esempi.
            Indico anche il sito di wikipedia che le da un indicazione generica. http://it.wikipedia.org/wiki/Duplicazione_genica

          • Affermi:
            “Non esiste nessun “repressore attivo” evidenziato dalla ricerca”

            Ma non è necessario che ci sia scritto nella ricerca: se il trasporto del citrato è attivo in condizioni anaerobiche e inattivo in condizioni aerobiche, deve esserci un repressore responsabile di ciò.

            Non serve leggere la ricerca, basta leggere il manuale di III scientifico.

            Che poi la duplicazione del materiale genetico fornisca il materiale per eventuali future mutazioni è un’affermazione che non dimostra nulla… duplica solo affermazioni che lo sostengono!
            Ma non per questo diventano più vere.

            Per il resto rimando alla risposta di Leonetto e alla seconda parte che scriverò sull’argomento.

  3. Bell’articolo Enzo,certamente molto meglio,per la comprensione,l’informazione e l’analisi dividere la cosa in più parti.

    “It wasn’t a typical mutation at all, where just one base-pair, one letter, in the genome is changed,” he said. “Instead, part of the genome was copied so that two chunks of DNA were stitched together in a new way. One chunk encoded a protein to get citrate into the cell, and the other chunk caused that protein to be expressed.”

    Si…come avevo avuto modo di re già:
    http://www.enzopennetta.it/2012/10/pikaia-darwin-ha-fatto-un-errore/#comment-8423
    http://www.enzopennetta.it/2012/10/pikaia-darwin-ha-fatto-un-errore/#comment-8488

    “L’innovazione” principale è stato un cambiamento nella regolazione dell’operone citrato, causata da un riarrangiamento che lo portò vicino a un nuovo promotore”

    Avvenuta in una serie di passi che avvengono in casi di “adattamenti complessi ”

    E si un esempio di riutilizzo di informazioni esistenti in un nuovo contesto, producendo così una nuova nicchia di E. coli,ma se la definizione di innovazione è qualcosa di veramente nuovo, come una molecola di trasporto nuovo o un nuovo enzima, allora no, questo adattamento non la porta davvero..

    etc..
    già scritto in quei commenti…

    “La corroborazione della teoria neodarwiniana non può venire da un caso in cui si certifica una perdita di funzione, anche se questo dovesse comportare un aumento di fitness in un determinato ambiente (che comunque per puntualizzare in questo caso è artificiale).”

    “Solo in termini assoluti, in termini di time frame piu corti si puo tranquillamente accettare perdita di funzioni solo se accompagnati da un incremento del fitness del organismo. L’evoluzione non ha una direzione.”

    Ni.Di una possibile direzione non frega nulla a nessuno,nel senso che non manca ne abbisogna di particolare corroborazione/i. C. elegans, C. briggsae,Cryptasterina E.coli cche mangia citrato sono tutte varietà di alcuni pool genici ma il pool genico cambia in continuazione,perché gli individui nascono e muoiono. Però se l’informazione è sempre la stessa non si va da nessuna parte e microevoluzioni che si verificheranno saranno sempre e solo microevoluzioni.
    O altrimenti serve quella “cellula di Dio” che riporta Piero.

    Quel tipo di evoluzione e tutto quanto è possibile far rientrare nella microevoluzione nessuno lo contesta,non si capisce perchè vi sia tanto affanno a mostrare con vigore ed accanimento la validità di queste cose come ci fosse una folla che dicesse il contrario.. Ad ogni modo che si insista su una cosa che già un manuale da III Liceo dice abbastanza chiaramente fa pensare eh..
    Fra le altre cose,che una notizia di cui dovrebbero “bullarsi ” quelli dell’ID poichè ha dato ragione di quanto anticipava M.Behe,venga fatta rimbalzare a destra e a amnca come prova dell’evoluzione neodarwiniana in laboratorio e nascita di una nuova specie con meccanismi neodarwiniani ha quasi del comico..
    Dire che questo sia un caso di macroevoluzione non questione di punti di vista o di definizione..rasenta un po’ il delirio..

  4. http://www.enzopennetta.it/2012/10/informazione-e-disinformazione/#comment-8671

    “Bhe in verita c’è una valanga di altre prove che
    attestano a questo. Un punto fondamentale pero e che scimmie sono ns cugine e nessun studio scientifico dira mai che l’uomo si e svilupato dalle scimmie.”

    Mm..direi proiprio di no.Non ce n’è mezza di prova…altrimenti non ci sarebbe discussione.
    E poi..
    http://whozoo.org/mammals/Primates/primatephylogeny.htm
    Il neodarwinismo postula che l’antenato comune fra chimp e bonobo avesse un antenato a comune con l’homo e poi la parentela con orangutan e gorilla a ritroso..gibbone etc..
    cosa sono se non scimmie?papere?banane?uomini?pesci?
    A me pare che tutti gli studi neodarwinisti dicano invec e che l’uomo si e svilupato dalle scimmie,iniziando da Darwin stesso…
    (Tanto per chiarire eh..scimmia non è uguale a scimpanzè..)

    “Ora mi dici quale delle due stringe ha piu informazioni:

    TGTGTTTAACGGAGCTGATTTCTT
    TAAGTTTAACGGAGCTGATTTCTT

    Qui c’è un po’ da ridere sinceramente…
    A parte che il passaggio da A a B non è che deve per forza essere coinvolto da “piu informazioni” in B,ma in B deve esserci nuova informazione, son due cose diversissime eh…
    Qui ci vuole un po’ di teoria dell’informazione ..sennò..siam a parlare del nulla…ragionare alla “gene egoista di Dawkins” è profondamente sbagliato e si vedono le cose in un modo che non è quello della realtà delle cose.
    Faccio un esempio che magari risulta più chiaro anche per chiunque venga a leggere.
    Definiamo informazione ,nella teoria dell’informazione,quell’elemento che opera un ordinamento di simboli o cifre in modo da dare ad essi un significato compiuto e lo misuriamo in bit.
    Se abbiamo un ambiente Open Office ed abbiamo un file .odt in cui c’è scritto “ciao” abbiamo questa informazione, e se si osserva l’equivalente binario, si vedrà una certa sequenza che poi verrà codificata in modo che si possa leggere “ciao”.
    Se quel file viene convertito da OpenOffice in un file .doc e poi aperto in ambiente Word vedremo che abbiamo la stessa informazione “ciao”.Eppure la sequenza di 1 e 0 corrispondente è notevolmente differente da quella dell’odt.L’informazione è la stessa ma in ambiente differente è possibile utilizzarla.l’Odt Word non l’avrebbe aperto.
    Se il file doc avesse contenuto “ciao. La password del router è: “Password”ci sarebbe stata però nuova informazione,oltre che nuovo formato.

    Ora torniamo all’aspetto “biologico”.
    Il limite fra microevoluzione e macroevoluzione è presto segnato.La microevoluzione è la variazione all’interno dei “tipi”,magari termine ambiguo ma difficile definirlo col termine che dovrebbe essere specie,ma specie nel senso più generale ed attinente al mondo naturale,non specie biologica.La microevoluzione è un “cambiamento orrizzontale” o a perdere,al limite del confine genetico,inizia una macroevoluzione allorchè da una specie si ottitene una seconda specie in cui è possibile individuare, a seguito una mutazione genetica,di una serie di mutazioni,di un processo evolutivo etc..un nuova informazione nel genoma,il verificarsi di nuova funzione.Non adattamenti,no rotture,non mescolanze da ibridazioni,non borrowed information,ma proprio nuova informazione.
    Il punto è che le variazioni che si verificano,artificiali o naturali che portano aumento della fitness portano impoverimento della specie e migliorando una caratteristica,rendendo disponibile una funzione in condizioni differenti etc..pagano lo scotto di perdere in informazione di base.Questo si traduce si in un vantaggio,ma molto probabilmente,se rimangono isolati troppo a lungo quel vantaggio si rivela la buona via per l’estinzione come in questo caso:
    http://www.enzopennetta.it/2012/05/neodarwinismo-alla-deriva/
    E’ necessario invece che man mano in un certo qual tempo debba costruirsi da una certa informazione, una nuova informazione di base se si vuole un nuovo tipo,una vera nuova specie.
    Nessuno vuole e richiedi macroscopici cambiamenti tutti in un colpo,chi l’ha detto?Però se in numerosissime generazioni non si verifica nient’altro che “nuove versioni”,”nuove rimescolazioni”,”migliorie”,rotture,scomposizioni etc.. dell’informazione precedente non è possibile andare oltre i limiti dell’eq.di Hardy-Weinberg e non potrà mai avvenire la “vera evoluzione” quella postulata in lunghi tempi dal neodarwinismop pèer spiegare l’origine delle nuove “specie”.

    Infatti poi:
    “Inanzi tutto bisogna chiarire che un tempo definito non e richiesto per la teoria.”
    No che non è richiesto ma i fossili danno un certo lasso di tempo in cui devono verificarsi,secondo ipotesi neodarwinista,determinati sostanziali,necessari ed importanti cambiamenti.Quindi limiti temporali ci sono eccome.

    Io non credo sia un concetto così misterioso o equivoco da

    Pertanto la risposta ovvia a ciò:
    “Inoltre se dici che non ci sono nuove funzione mi dici come e stato possibile usare il citrato in condizioni aerobiche?”

    Riconosciuto comunque dallo stesso Blount è che non c’è nuova funzione.

    P.S.

    “Queste mutazioni, una volte selezionate e fissate, danno origine a nuove funzioni, o come in questo caso forse riabilitano funzioni pre-esistenti. Questo non cambia il fatto della diversità evidente delle due specie che è dopo tutto il fatto del evoluzione.”

    Certo che c’è evoluzione,ma microevoluzione come ha scritto sopra Enzo.nessuno lo nega.

    “Ultimo punto non credo ciecamente, ho una multitudine di ricerche sotto mano con tanto di dati. Tu cosa hai?”
    I fatti che muovono sempre contro mai a favore del neodarwinismo.Fossili,esperimenti,osservazione delle specie,genetica e biologia,teoria dell’informazione etc etc..

      • Leonetto scrive:
        22 ottobre 2012 alle 18:06

        “E si un esempio di riutilizzo di informazioni esistenti in un nuovo contesto, producendo così una nuova nicchia di E. coli,ma se la definizione di innovazione è qualcosa di veramente nuovo, come una molecola di trasporto nuovo o un nuovo enzima, allora no, questo adattamento non la porta davvero..”

        In questo caso abbiamo sia molecole di trasporto nuova, e nuovi enzimi. “This new module causes the production of a protein that allows the bacteria to bring citrate into the cell when oxygen is present. That is a new trick for E. coli.” Quindi questa abilità non esisteva prima.

        Sei libero di provare che Lenski si sbaglia indicando che la produzione della proteina avveniva anche prima.

        “Però se l’informazione è sempre la stessa non si va da nessuna parte e microevoluzioni che si verificheranno saranno sempre e solo microevoluzioni.”

        L’informazione cambia con ogni mutazione altrimenti hai clonazione.

        “…ragione di quanto anticipava M.Behe”

        Behe aveva anticipato una serie di mutazioni accumulative in 3 fasi? Si? Da quello che so è proprio qualcosa che lui aveva escluso.

        “Dire che questo sia un caso di macroevoluzione non questione di punti di vista o di definizione..rasenta un po’ il delirio..”

        Ti ricordo che hai ancora una volta mancato di dare una definizione al termine microevoluzione. Finche non fornisci una definizione con un boundry definito non ha senso che tu parli di macro/microevoluzione.

    • Leonetto scrive:
      22 ottobre 2012 alle 23:26

      “Mm..direi proiprio di no.Non ce n’è mezza di prova…altrimenti non ci sarebbe discussione.”

      Caspita stai rifutando il fatto della discendenza commune delle specie. Pero… Persino Behe non lo contesta. Non so se questo è il thread giusto per approfondire questo punto ma sarei curiosissima di vedere le prove che hai a favore della tua posizione.

      “Il neodarwinismo postula che l’antenato comune fra chimp e bonobo avesse un antenato a comune con l’homo e poi la parentela con orangutan e gorilla a ritroso..gibbone etc..”

      Scimmia è un termine generico e non identifica una specie.

      “A me pare che tutti gli studi neodarwinisti dicano invec e che l’uomo si e svilupato dalle scimmie,iniziando da Darwin stesso…”

      Ottimo non ti resta che provarlo, posta il link di una ricerca scientifica che sostiene quanto hai appena detto.

      “Il limite fra microevoluzione e macroevoluzione è presto segnato.La microevoluzione è la variazione all’interno dei “tipi”,magari termine ambiguo ma difficile definirlo col termine che dovrebbe essere specie,ma specie nel senso più generale ed attinente al mondo naturale,non specie biologica.

      Ah finalmente definisci il termine e si svela “the prestige”. Quanto hai definito in termini inglesi viene indicato come “shifting the goalpoast”. Hai comesso 2 errori.

      Il primo è di richedere alla teoria di fare cio che la teoria stessa dice che non accade. Non richiedi solo la speciazione ma di più. Ti ricordo che la teoria stessa ci dice che non e possibile cambiare classe / ordine. Un esempio e la classe mammiferi, i cetacei anche con tante diversita rispetto ai loro cugini piu vicini gli ipopotami sono cmq della stessa classe!

      Secondo errore, se cambi un termine da una parte del equazione devi cambiare il termine dal altra parte del equazione. Hai modificato la definizioni di micro-evoluzione quindi dovresti addare la teoria per comprendere la nuova definizione altrimenti non ha senso l’intero discorso.

      “La microevoluzione è un “cambiamento orrizzontale” o a perdere,al limite del confine genetico,inizia una macroevoluzione allorchè da una specie si ottitene una seconda specie in cui è possibile individuare, a seguito una mutazione genetica,di una serie di mutazioni,di un processo evolutivo etc..”

      Fin qua concordo, infatti gli esperimenti di Lenski mostrano un processo evolutivo un mutamento a fasi.

      “un nuova informazione nel genoma,”

      Esatto questo è presente negli esperimenti di Lenski, vi e nuova informazione legata alla codifica di nuove proteine mai esistite prima. In senso lato pero devi essere d’accordo che ogni mutazione rappresenta una nuova informazione nel genoma e di mutazioni c’è ne sono molte altrimenti saremo tutti cloni.

      “il verificarsi di nuova funzione.”

      Esatto questo e stato provato da lenski, infatti prima della generazione 20.000 NESSUN e.colli è stato in grado di usare il citrato. Poi provare che questo non sia vero fornendo dati che indicano il consumo di citrato in generazioni pre-20.000 della popolazione Ara-3. Sappiamo entrambi che non lo farai perche non c’è quindi siamo costretti ad accetare la nuova funzione come NUOVA.

      “Non adattamenti,”

      Hmm vorresti escludere l’addatamento alla specie al suo ambiente??!!! Ma se questo è uno dei fattori principali della teoria. Hai per caso prove che gli esseri non si adattano al ambiente????

      “no rotture,”

      Immagino escludi mutazioni genetiche… pero…

      “non mescolanze da ibridazioni,”

      Ibridazione e una via riconosciuta per il formarsi di nuove specie, perche la elimini arbitrariamente?

      “non borrowed information,”

      Mai sentito parlare di Horizontal gene transfer??? Escludi quindi questo meccanismo di apporto di informazioni genetiche e evoluzione?????

      “ma proprio nuova informazione”.

      Ecco ti faccio un esempio guardiamo queste sequenze:

      Sequenza 1) TGTG TTTA ACGG AGCT GATT TCTT
      Sequenza 2) TGTG TTTA ACGG AGCT GATT TCTT GATT TCTT
      Sequenza 3) TGTG TTTA ACGG AGCT GATT TCTT GATT TCTC

      Noterai che la seconda sequenza ha in se una duplicazione. E fin qui niente di nuovo diresti. Ma guarda cosa succede alla sequenza 3. Ovviamente la parte duplicata non puo e non e immune a mutazioni. Quindi abbiamo un segmento nuovo. Abbiamo nuove informazioni.

      Apparte il fatto che ogni mutazione anche la piu semplice apporta per forza delle nuove informazioni la dimostrazione la vedi paragonando la sequenza 2 e la 3. Le stringe sono identiche apparte una piccola mutazione alla fine. Le informazioni contenute non sono piu le stesse, abbiamo delle informazioni nuove.

      “Il punto è che le variazioni che si verificano, artificiali o naturali che portano aumento della fitness portano impoverimento della specie e migliorando una caratteristica,rendendo disponibile una funzione in condizioni differenti etc..pagano lo scotto di perdere in informazione di base.”

      Questo è apretamente falso. Come indicato da questo studio (ma anche in tantissimi altri!!!) l’aumento del fitness e avenuto anche tramite un duplicazione genetica (fra altre mutazioni) quindi il genoma e piu grande. Lenski ha calcolato l’aumento di informazioni nel genoma e questi sono chiaramente indicati sia nella figura 2 che nella tabella 9. Se ovviamente non sei d’accordo puoi postare qui il link del analisi genomica che indica una diminuzione. Inoltre basta pensare che una cipolla ha un genoma ben piu lungo di quello di un umano.

      “Questo si traduce si in un vantaggio,ma molto probabilmente,se rimangono isolati troppo a lungo quel vantaggio si rivela la buona via per l’estinzione come in questo caso:”

      Confondi 2 concetti, uno e un discorso sul fitness generico l’altro riguarda la caduta di varietà genetica in una specie.

      “Riconosciuto comunque dallo stesso Blount è che non c’è nuova funzione.”

      Che strano non fanno che ripetere in TUTTA la ricerca che vi è una nuova funzione…Mi indicheresti dove Blount secondo te indica “no new function arose” o simile grazie…

      “I fatti che muovono sempre contro mai a favore del neodarwinismo.Fossili,esperimenti,osservazione delle specie,genetica e biologia,teoria dell’informazione etc etc..”

      Ah si, quali fatti? Finora tutte le ricerche che ho visto senza eccezione confermano la teoria!

      Giusto per aggiungere ecco un nuovo studio appena pubblicato… Indovinate cosa conferma:

      http://www.sciencedaily.com/releases/2012/10/121022145340.htm

      Che dite chiudiamo il triste capitolo del “duplicazione non porta a evoluzione” e “non esistono nuove informazione”?….

      • Un sacco di sofismi..è tutto falso e praticamente ci sarebbe da ribattere su ogni cosa(fra l’altro a molte cose le era già stato rispoto anche da Enzo ) ..grossomodo comunque si ripeterebebro cose già dette,infatti molte sono persino già contenute nei commenti precedenti..

        per esempio:
        “Caspita stai rifutando il fatto della discendenza commune delle specie. Pero… Persino Behe non lo contesta. Non so se questo è il thread giusto per approfondire questo punto ma sarei curiosissima di vedere le prove che hai a favore della tua posizione. ”

        laddove antenato comune rappresenta il “punto di partenza” di un ramo microevolutivo nessuno lo nega e nella giusta definizione non si esce dalla specie,fatto ben diverso sono le linee presunte che collegano specie differenti.
        Cosa ben diversa è l’antenato a comune fra lupi e volpi e fra orso polare e orso bruno da quello presunto fra l’antenato comune di bonobo e chimp e l’antenato a comune degli homo.Dei quali non v’è traccia lacuna nè prova di esistenza.

        ma così come :
        “Mai sentito parlare di Horizontal gene transfer??? Escludi quindi questo meccanismo di apporto di informazioni genetiche e evoluzione?????”

        Ovvio che si esclude!..va anche spiegato?

        “Ibridazione e una via riconosciuta per il formarsi di nuove specie, perche la elimini arbitrariamente?”

        Anche peggio…

        “Hmm vorresti escludere l’addatamento alla specie al suo ambiente??!!! Ma se questo è uno dei fattori principali della teoria. Hai per caso prove che gli esseri non si adattano al ambiente????”

        Dal fatto che porti alla macroevoluzione certo,tutto quanto è possibile osservare con gli adattamenti mostra sempre qualcosa che non esce dalla specie…anzi..

        Ma come si può lontanamente sostenetere che cose come queste due portino “nuova informazione” e diano sostegno all’evoluzione neodarwiniana?
        O non la si conosce bene o si è in malafede.tertium non datur.
        Probabilmente lei non ha ben chiaro il concetto di informazione e di nuovo e così anche peggio di nuova informazione ed è per questo che va imbrogliandosi..

        “Il primo è di richedere alla teoria di fare cio che la teoria stessa dice che non accade. Non richiedi solo la speciazione ma di più. Ti ricordo che la teoria stessa ci dice che non e possibile cambiare classe / ordine. Un esempio e la classe mammiferi, i cetacei anche con tante diversita rispetto ai loro cugini piu vicini gli ipopotami sono cmq della stessa classe! ”

        Non ci siamo..ma che sta dicendo o peggio cercando di farmi dire?Ho mai detto che da una rana deve saltar fuori un uccello?Non mi pare proprio..ho detto che la speciazione biologica non è per niente sufficiente né una prova né un esempio di formazione di “nuove specie” o di come esse possano formarsi.Dei Cetartiodattili secondo il neodarwinismo si sono evoluti e differenziati in cammelli,suidi,ruminanti,negli ippopotami e nei cetacei.ce ne vuole di nuova informazione eh per fare quelle ipotetiche evoluzioni..
        Tutti queste specie hanno un sacco di funzioni che quel ipotetico progenitore Cetartiodattilo non aveva e se i passi evolutivi eran fatti solo da riciclo della stessa informazione in più versioni…da tutto quanto concerne
        ibridazioni, speciazioni biologiche, incroci, chimere, mutazioni intra-specie (come si hanno casi di robertsonian fusion, tandem fusion etc..)col cavolo che secondo il meccanismo neodarwiniano si sarebbero mai ottenute quelle specie.

        “Secondo errore, se cambi un termine da una parte del equazione devi cambiare il termine dal altra parte del equazione. Hai modificato la definizioni di micro-evoluzione quindi dovresti addare la teoria per comprendere la nuova definizione altrimenti non ha senso l’intero discorso.”

        Addare?Presupponendo che sia adattare,è sufficiente far notare che il cambio di definizione viene fatto dagli evoluzionisti neodarwinisti.Quindi lei critica un atteggiamento proprio dei neodarwinisti non mio.lo condivido.
        Non ho fra l’altro modificato la definizione di microevoluzione l’ho semplicemente riportata a quello che traspare dall’osservazione dei fatti.
        La macroevoluzione come somma di microevoluzioni o come proprietà emergente da tale somma non ha alcun riscontro(il dott.Guliani così come il prof.masiero riportavano anche uno studio che avrebbe dimostrato come questo sia proprio impossibile fra l’altro e dovrebbe uscire a breve)
        Se sopraggiunge tramite una o più mutazioni,tramite uno o più processi evolutivi nuova informazone e si ha una nuova funzione allora si hanno superato i limiti della microevoluzione altrimenti non si va da nessuna parte.
        C’è cambiamento,adattamento,tante cose ma nessuna vera “nuova specie ” sorge poichè non possono ottenersi tutte quelle nuove informazioni richieste.

        per riprendere anche :

        “Scimmia è un termine generico e non identifica una specie.”

        Eh già..e quindi?E che ho detto io?
        Ho detto che

        “Il neodarwinismo postula che l’antenato comune fra chimp e bonobo avesse un antenato a comune con l’homo e poi la parentela con orangutan e gorilla a ritroso..gibbone etc..
        cosa sono se non scimmie?papere?banane?uomini?pesci?
        A me pare che tutti gli studi neodarwinisti dicano invece che l’uomo si e svilupato dalle scimmie,iniziando da Darwin stesso…
        (Tanto per chiarire eh..scimmia non è uguale a scimpanzè..)”

        termine generico con cui comunemente si identifica tanto cita di Tarzan,King kong,jack dei pirati dei Caraibi, l’amico di dolce remì quanto anche tutte i protagonisti di “Planet of the apes”.
        Quindi quell’antenato che poi si sarebbe evoluto secondo il neodarwinismo in homo cos’altro sarebeb se non una scimmia?Ci sono tutte scimmie in quel ramo eccetto l’uomo..non so…mah..
        Ed appunto tornando all’uomo è necessaria l’acquisizione di diversa nuova informazione ed in un certo tempo da questa scimmia affinchè si arrivi all’uomo..

        “Giusto per aggiungere ecco un nuovo studio appena pubblicato… Indovinate cosa conferma:

        http://www.sciencedaily.com/releases/2012/10/121022145340.htm

        Conferma che lei ha capito poco o nulla su cosa sia nuova informazione e nuova funzione
        Lo studio più di specificare magari meglio come operi a certi livelli la selezione ma non dice nulla di quanto crede o di quanto sbandierano certe riviste e blog..
        banalmente un miglioramento di una funzione non è una nuova funzione..una nuova funzione è una nuova funzione..

        “The bacteria carried a gene involved in making the amino acid histidine that had a secondary, weak ability to contribute to the synthesis of another amino acid, tryptophan.”

        mah….

        “Che dite chiudiamo il triste capitolo del “duplicazione non porta a evoluzione” e “non esistono nuove informazione”?….”

        E’ veramente inutile discutere se si parlano due lingue diverse.Ma nemmeno per un istante mi sarei mai convinto che lei mutasse minimamente il pensiero,però credo che chi legge possa avere diversi elementi per avere una buona visione delle cose.
        Per il resto quoto Enzo:
        “Per il resto rimando alla seconda parte che scriverò sull’argomento.”

        ma è comunque tutto chiaro:
        http://www.enzopennetta.it/2012/10/informazione-e-disinformazione/#comment-8699

        Il suo ragionare è tutto incentrato (lo si comprende da quanto traspare nei suoi commenti qui ed altrove) su due opere di Dawkins,l’orolgiaio cieco e il gene egoista,ben largamente confutate e criticate dagli stessi neodarwinisti..preso atto di ciò c’è veramente poco o nulla da dire…
        Il problema è avere non chiare diverse cose relative alla teoria dell’informazione oltre all’essere assorbita dal paradigma..

        P.S.

        Così tanto per dire..non è una strana coincidenza che certi studi escan tutti belli assieme e si dia con enfasi la notizia di aver dimostrato in laboratorio l’evoluzione neodarwiniana?

        • Leonetto scrive:
          24 ottobre 2012 alle 02:41

          “bonobo e chimp e l’antenato a comune degli homo.Dei quali non v’è traccia lacuna nè prova di esistenza.”

          Mentre è vero che non e ancora stato scoperto il fossile del Pan Prior, per fortuna non serve. In quanto le prove genetiche sono schiaccianti a favore del esistenza di un antenato comune. Non so se questo è il thread giusto per approfondire cmq basta nominare tre cose: Pseudo geni, retrovirus, e cromosoma 2. Strano che Lei non concorda con Behe su questo punto…

          “Ovvio che si esclude!..va anche spiegato?” (risposta riguardo al traferimento genetico orizzontale)

          Quindi lei ignora le seguenti 10.000 ricerche?
          http://scholar.google.it/scholar?start=10&q=horizontal+gene+transfer+evolution&hl=it&as_sdt=0

          Forse hai una ricerca che indica che questo non puo portare al evoluzione… Si senta libero di postarla qui.

          “Anche peggio…” (risposta riguardo al ibridazione)

          Per sostenere questo dovrebbe confutare solo queste poche ricerche.
          http://scholar.google.it/scholar?q=hybridization+evolution&hl=it&as_sdt=0&as_ylo=2000&as_yhi=2012

          Forse hai una ricerca che indica che questo non puo portare al evoluzione… Si senta libero di postarla qui.

          “Dal fatto che porti alla macroevoluzione certo,tutto quanto è possibile osservare con gli adattamenti mostra sempre qualcosa che non esce dalla specie…anzi..”

          Ottimo hai delle prove per quanto detto, una ricerca? uno studio? no? Come mai?

          “Ma come si può lontanamente sostenetere che cose come queste due portino “nuova informazione” e diano sostegno all’evoluzione neodarwiniana?”

          Strano ho appena indicato uno studio che indica chiaramente nuova informazione… Perche continui a ignorare i fatti? Osserva la figura 2 e la tabella 9. E chiaramente indicata l’aumento di informazioni.
          http://www.nature.com/nature/journal/v489/n7417/extref/nature11514-s1.pdf

          “Probabilmente lei non ha ben chiaro il concetto di informazione e di nuovo e così anche peggio di nuova informazione ed è per questo che va imbrogliandosi..”

          I concetti di informazione li conosco molto bene, come ho dimostrato nella post precedente. In fatti lei non è stato ancora in grado a rispondere alla domande semplice semplice che ripropongo qui per sua convenienza (Questa volta usando dati veri):

          Sequenza 1) GAT CTCC GTG
          Sequenza 2) GCT CGTT GTG

          Queste elencate sono delle mutazioni realmente avvenute. Una crea una serie di proteine l’altra un altra differente. Quindi entrambe danno vita a funzioni diverse. Quale di queste ha piu informazioni? Quale di queste rappresenta una mutazione? Ora non se la prenda so per certo che lei (e nessun altro, per la verità) riesce a rispondere alle mie domande. Questo significa che non siamo in grado di usare informazione come metro. Questa è una semplice dimostrazione che NON ha alcun senso parlare di informazioni. Al limite si puo parlare di informazioni nel senso di quantità ma questo anche non ha alcun significato (anche se la duplicazione genetica aumenta la quantita di informazioni, ma se per quello anche il trasferimento orizzontale). Per concludere e togliere ogni dubbio ecco due esempi veri: Una cipolla ha circa 12 volte le informazioni genetiche di un umano, mentre un ameba ha 200 volte la quantità di informazioni.

          “Quindi quell’antenato che poi si sarebbe evoluto secondo il neodarwinismo in homo cos’altro sarebeb se non una scimmia?Ci sono tutte scimmie in quel ramo eccetto l’uomo..non so…mah..”

          Ahh bene non ti resta che postare qua un ricerca scientifica che identifica come scimmia (monkey) un antenato di uomo. Chissa perche sento che non lo farai…

          ““The bacteria carried a gene involved in making the amino acid histidine that had a secondary, weak ability to contribute to the synthesis of another amino acid, tryptophan.”

          mah….”

          Dai su leggi la frase immediatamente dopo… “In their study, they removed the main tryptophan-synthesis gene from the bacteria and watched what happened.”

          Ora forse il concetto è piu chiaro vero?

          “E’ veramente inutile discutere se si parlano due lingue diverse. Ma nemmeno per un istante mi sarei mai convinto che lei mutasse minimamente il pensiero,però credo che chi legge possa avere diversi elementi per avere una buona visione delle cose.”

          In verita io sono molto aperta a soluzioni innovative, pero bisogna guardare i fatti. Inoltre trovo la conversazione molto interessante.

          “Così tanto per dire..non è una strana coincidenza che certi studi escan tutti belli assieme e si dia con enfasi la notizia di aver dimostrato in laboratorio l’evoluzione neodarwiniana?”

          Mah io vedo una costante crescete di ricerche simili. Probabilmente grazie alla continua discesa dei prezzi dei sequenziatori genetici.