Pinguini negazionisti?

79

I pinguini imperatore anziché estinguersi per i cambiamenti climatici (come prevede la teoria dell’AGW) si sono solamente trasferiti in altri luoghi.

.

E così in un colpo solo negano i danni del Global Warming e un meccanismo evolutivo largamente accettato.

.

Non c’è niente da fare, sembra proprio che l’Antartide non voglia saperne di adeguarsi alle teorie più diffuse sui cambiamenti climatici e sulla componente climatica dell’evoluzione. Avevamo appena fatto in tempo a segnalare la riluttanza dei ghiacci antartici a sciogliersi secondo copione (vedi CS Global Warming: l’Antartide è negazionista), che adesso salta fuori che neanche i pinguini imperatore vogliono adeguarsi all’allarme che li vedeva in via di estinzione per via dei cambiamenti climatici causati dall’uomo (AGW).

Eppure un recente studio pubblicato su Nature Climate ChangeProjected continent-wide declines of the emperor penguin under climate change” pubblicato il 29 giugno 2014, giunge alla conclusione che nel 2100 la popolazione potrebbe essere diminuita del 19% per via dei cambiamenti climatici.

Sulla scia di questi preveggenti studi la stampa continua a lanciare disperati annunci sulla prossima dipartita dei simpatici pennuti, tra gli ultimi casi l’articolo pubblicato su FocusLa marcia dei pinguini… verso l’estinzione” del 30 giugno scorso, un articolo nel quale, partendo dalla pubblicazione di cui si è detto su Nature, si raggiunge un paradosso ineguagliabile dichiarando che il pericolo esiste sia che i ghiacci diminuiscano sia che essi aumentino (secondo loro i pinguini dovrebbero esistere solo in presenza di un clima perfettamente stabile) ma che raggiunge il sublime segnalando addirittura che per ora i pinguini sono in aumento ma non illudiamoci, con cronometrica precisione inizieranno a sparire dal dal 2040:

pinguini focus

Insomma, si afferma che i pinguini vengono messi in difficoltà sia dall’aumento che dalla diminuzione dei ghiacci, ma per ora questo non vale, infatti nonostante i cambiamenti climatici le colonie continueranno ad aumentare fino al 2040. Chi è in grado di accettare questo ragionamento può mandare giù qualsiasi cosa, ed è questa in fondo l’essenza del polically correct.

Ma sebbene il destino dei pinguini venga indicato ormai segnato da Nature, era in precedenza stato pubblicato un altro studio, stavolta di PlosOneEmperor Penguins Breeding on Iceshelves” che nel gennaio scorso spiegava come anziché perire ed estinguersi per via dei cambiamenti climatici, i pinguini Imperatore preferiscano semplicemente spostarsi in regioni più favorevoli… cosa tra l’altro segnalata alla fine dello stesso articolo su Focus che in fondo non sa più che posizione prendere.

E così, in conclusione, dopo aver saputo che non solo i ghiacci dell’Antartide non sono in scioglimento, e che i pinguini non son in via d’estinzione a causa nostra, dobbiamo giungere alla conclusione che l’evoluzione non ha tra i suoi “motori” i cambiamenti climatici perché, come sospettato da molti anche qui su CS, se il clima cambia le specie si spostano, e così addio per sempre alla teoria che voleva l’uomo essere diventato bipede per via della sparizione della foresta in favore della savana.

L’Antartide sembra insomma essere veramente un po’ indisciplinata e peggio ancora negazionista in tutte le sue manifestazioni, bisogna che la smetta e cominci ad adattarsi alla teoria.

 

_______________________________________________________________________________________________________

Aggiunta del 14/07/2014 ore 00,14 – da Nature Biotechnology “Insect resistance to Bt crops: lessonsfrom the first billion acres” del giugno 2013:

 

 

Bt toxin resistance

.

.

.

.

Share.

About Author

Laureato in Biologia e in Farmacia, docente di scienze naturali Nel 2016 ha pubblicato "L'Ultimo uomo" . .

79 commenti

  1. Scusate la mia insistenza, ma volevo intendere meglio.
    La teoria AWG, oltre che appoggiare bene la Sintesi Moderna, che fa capo al capitalismo transumanista che per garantire l’ordine e la potenza di chi fa principalmente capo all’odierno paradigma vuol convincere l’uomo di essere un animale, dovrebbe far capo anche anche alla deindustrializzazione dei paesi del Terzo Mondo e più generalmente al controllo demografico malthusiano, oppure sto errando?
    (non vorrei aver assunto toni di vena “complottistica” – parafrasando un altro vostro articolo, non siam governati da sadici ma nemmeno da galantuomini).

    • Prego, insisti pure…
      Colgo l’occasione per precisare alcuni punti.
      -La teoria dell’AGW non appoggia direttamente la SM ma ha causato un frequente ricorso ai cambiamenti climatici per spiegare i processi evolutivi, come emerso proprio in questi giorni nell’articolo “Evoluzione umana, ancora una non-spiegazione“.
      -La teoria neo-darwiniana è utile al fine di costruire una nuova visione dell’uomo, un homo-economicus, che sottostà a logiche di competizone e di allevamento (eugenetica, eutanasia).
      -Le teorie neo-malthusiane sono finalizzate a mantenere lo status quo (questo era il motivo fin dai tempi di Malthus) per cui i ricchi restano ricchi e i poveri restano poveri, e restano poveri per copla loro che continuano a riprodursi…
      -La teoria dell’AGW bocca d fatto l’industrializzazione dei paesi poveri e in questo senso è convergente con le politiche neomalthusiane di birth control.

      Questo non è complottismo, è un’analisi che può essere contestata solo con una contro-analisi.
      Comunque sono pronto ad andare a chiedere asilo politico ai pinguini negazionisti… 🙂

      • La ringrazio, professore.
        Mh: c’è chi se ne muore, per vivere in paesi Europei o Nordamericani (pulsione geografica). Altri, invece, rimpiangono un qualsivoglia passato (p. temporale).
        Io propendo, allora, per l’anacoretismo.
        E’ impossibile dire qualcosa di intelligente e vero sopra gli esseri umani, quindi non me ne vogliate se, con il mio parere, potessi apparire stolto.

        Non vi stancate mai voi di vedere tutta questa mediocrità?
        Come fate ad andare avanti?

        • Alio, è proprio perché siamo stufi della mediocrità che ci diamo da fare per elevare un po’ il dibattito!
          Riguardo l’anacoretismo, ne ho la massima considerazione.

  2. Ho trovato un vecchio numero dell’Internazionale – del 2009 – la cui copertina e principale servizio (5 o 6 pagine) erano dedicati a un climatologo definito “Lo scienziato ribelle” e odiato da tutti i governanti perchè, diceva il giornalista, voleva mettere in guardia il mondo contro l’AGW, “più grave del previsto”. Mi sono detto: “Fammi vedere se trovo qualche previsione fatta nel 2009 che posso verificare se nel frattempo si sia avverata o meno”, ma purtroppo, in tutte quelle parole, non ho trovato niente da poter controllare… Qui ci dicono di aspettare il 2040 per veder sparire (ma speriamo di no) i simpatici pinguini: rischiano di fare come quei “profeti” che predicono la fine del mondo per una data precisa e poi, quando quella passa e il mondo è ancora qui, spostano la barra più avanti, tanto c’è sempre qualcuno disposto a prestare orecchio..

    • Marco, fa sorridere sentir definire un sostenitore dell’AGW “ribelle”, come tutti sanno i veri ribelli sono i contestatori dell’AGW, come Nigel Lawson che neanche essendo Lord ed ex ministro del governo Tatcher riesce ad avere spazio alla BBC.
      Vorrei anche sottolineare un passaggio del tuo intervento ” purtroppo, in tutte quelle parole, non ho trovato niente da poter controllare…” ecco, è proprio questo che distingue la scienza dalla non scienza, quindi lo “scienziato ribelle” non è ribelle e manco scienziato.

  3. “Se il clima cambia, le specie si spostano”

    E meno male, altrimenti il fenomeno dell’evoluzione cederebbe molto più spesso il passo a quello dell’estinzione.

    Quando le specie si spostano, trovano clima simile ma risorse differenti, oppure risorse simili ma clima differente (per fare due esempi) e si possono adattare più gradualmente.
    Oppure, nel caso della trasformazione da foresta a savana, non certo tutte le foreste hanno smesso di colpo di esistere, permettendo rifugio ai primati, chi però si avventurava anche oltre la foresta, che ormai era una zona estremamente contesa, aveva dei vantaggi.

    Queste dinamiche sono la base dell’evoluzione che nasce dall’osservazione empirica: ancora prima di costruire una teoria darwiniana o meno, ancora prima di avere idea di cosa sia il DNA, si osserva che la disposizione geografica delle specie affini, tanto diversificate quanto lo sono i vari habitat, suggerisce uno schema di radiazione adattativa, basato proprio su una successione di eventi migratori.

    • Matteo si rende conto che quelli che ha fatto sono dei racconti alla Kipling?
      Solo delle “just so stories”, di scientifico non c’è niente.

      • Giorgio Masiero on

        Il fatto è che per un darwinista come Matteo, “spiegazione scientifica” significa “ricostruzione possibile sperimentalmente incontrollabile”, in cui la stessa inverisimiglianza – dettata in molti casi dall’improbabilità estrema – non conta, tanto ci sono i famosi “tempi profondi” (Pievani) dove tutto è permesso che accada!

        Per loro non vale l’obbligo del metodo scientifico che impone di proporre solo ciò che possa, tramite una predizione, essere confermato o smentito sperimentalmente, anzi a priori questi credenti affermano che non si possono fare predizioni in biologia evolutiva, perché “se si riavvolgesse il nastro ecc., ecc.” (Gould).

        Se poi, per lo stesso fenomeno (per es., l’abiogenesi) ci sono 10 teorie darwiniane differenti, tanto meglio: mentre un fisico direbbe che almeno 9 di esse sono false, essi che dicono? Che abbiamo non una sola “soluzione” del problema, ma “molte” (Odifreddi)!

        Ve lo immaginate se la fisica, la chimica o… anche solo la giustizia nei tribunali funzionassero sul criterio della “ricostruzione possibile”, anziché sull’esistenza di “prove” controllabili con i fatti? Saremmo all’età della superstizione imperante…

        • Giorgio questa tua frase mi induce una riflessione:
          “Se poi, per lo stesso fenomeno (per es., l’abiogenesi) ci sono 10 teorie darwiniane differenti, tanto meglio: mentre un fisico direbbe che almeno 9 di esse sono false, essi che dicono? Che abbiamo non una sola “soluzione” del problema, ma “molte” (Odifreddi)!”

          Questa fallacia nel rtagionamento è favorita dalla somministrazione di test a risposta multipla, quelli a “crocetta” per intenderci, dove su una serie di ipotesi sicuramente un deve essere quealla giusta.
          E’ un test molto usato nelle scuole anglosassoni, personalmente non lo uso mai, propri perché è “diseducativo”, nel senso che diseduca a risolvre i problemi reali.

          • Vorrei sapere Enzo chi è(sono) i geni che li hanno importati …Certo su “grandi” numeri può risultare utile,ma ci sono alternative.
            Per esempio ricordo che io all’esame di Analisi matematica I e anche II avevo 3 prove ,2 erano lo scritto ed orale classici,una era diciamo “un test d’ammissione” alla prova scritta.
            In un tempo limitato si andavano a mettere risposte brevi,secche,alfanumeriche, senza scelta multipla.
            È ovvio che anche a scelta multipla il caso non può darti chissà che soddisfazione,ma sicuramente c’hai aiuti in più per “tirare a indoovinare” ed è ,concordo,diseducativo.
            Non avevo però pensato a questo collegamento Enzo..

          • Professore, trovo molto interessante il suo parere sui test a risposta multipla, in quanto didatta (da quanto intendo). In generale, è bene che un test a crocette sia accompagnato da una richiesta di dimostrazione nella pagina posteriore (riguardo i test matematici e scientifici), il che comporta la sua idea (non esistono tesi multiple). Scusi la piccola digressione.

          • A proposito; come saprà sono nuovo di qui. Mi chiedevo, professor Pennetta, essendo Lei da come intendo insegnante (liceale?), come proponesse ai suoi studenti i concetti e la trattazione del programma di biologia (soprattutto riguardo ai capitoli sulla teoria darwiniana).

          • @Leonetto
            i “geni” che hanno introdotto i test a risposta multipla sono quelli che sostengono la superiorità delle scuole di altri paesi, per principio.
            Ti posso dire che ho visto molti nostri studenti fare un periodo in scuole USA e poi li ho visti tornare notevolmente peggiorati: nessuna interrogazione orale; materie da studiare a scelta (tra cui falegnameria e baby sitting…); test a risposta multipla.
            Roba da distruggere anche lo studente più brillante.

            La realtà della ricerca scientifica e della vita in genere invece è paragonabile ad un foglio bianco dove noi dobbiamo fare le ipotesi (non scegliere tra quelle fatte da altri) e poi sceglierne una (tenendo in considerazione che nessuna di quelle che abbiamo fatto potrebbe essere quella giusta).

            @Alio
            riguardo ai test ho già risposto a Leonetto, quello a risposta multipla non va bene neanche con la spiegazione perché comunque è lo studente che deve fare l’ipotesi, non qualcuno che poi gli chiede di sceglierne una tra le preconfezionate.
            Io, notoriamente, come insegnate propongo l’insegnamento vero della teoria neo-darwiniana, fatto questo sono gli studenti stessi trovare i difetti.
            Come amo ripetere, in Italia sono il principale fautore dell’insegnamento completo e dettagliato della teoria neo-darwiniana.

    • Lo sapevo che qualcuno Enzo avrebbe commentato in questo senso quella frase..c’avrei scommesso…

      È chiaro che alimentazione,interazioni fra specie,clima,quindi migrazioni,deriva genetica interessino lo sviluppo di una specie nel tempo,e questo,per quanto si può osservare a livello microevolutivo è anche ben documentato.
      Sul bipedismo il neodarwinismo,diciamo almeno il più condiviso,quello ortodosso,prevede che questo sia comparso in ambiente di foresta ,inizialmente affiancando, senza sostituircisi, alla locomozione arboricola.
      Su tale ipotesi assunta aprioristicamente poi dopo è tutta una “just so story”, talvolta pregna anche di Lamarckismo..
      Lo stesso Tattersall vede nel bipedismo una exaptation (volgarmente preadattamento,una delle ‘toppe’ messe da Gould)rispetto alla vita nella savana,ricorrendo per spiegarla a quella “selezione per” criticata da Palmarini e Fodor.
      In buona sostanza non c’è spiegazione come per le altre cose su cui il neodarwinismo non da spiegazione,ma poi questa fpoggia anche sull’ipotesi che la funzione sia stata utile grazie ad una serie di altri adattamenti secondari(dalla dieta a facoltà mentali a funzioni termoregolative alla minzione…e via con just so stories..) che rendevano possibile vivere in ambiente di savana.Insomma non un caso di evoluzione neodarwiniana che coinvolga una specializzazione quanto invece una “flessibilità adattativa”.
      Dualmente per la ‘classica storia’ dell’evoluzione del cavallo,già comunque falsata per altri motivi..
      Quindi l’obsoleta,vecchia storia della conquista degli spazi aperti già da una ventina d’anni almeno non è più neanche nell’ipotesi ortodossa del neodarwinismo,così quindi ciò che da essa conseguiva.
      Di conseguenza il clima in una migrazione interesserebbe non l’evento ‘macroevolutivo’, quanto un adattamento,cosa non negata.
      Ma del resto chi nega l’adattamento?
      Se avviene, l’informazione che lo garantisce c’è già.
      Tutti i vari processi microevolutivi come ibridazioni, speciazioni, formazione di chimere, mutazioni intra-specie (robertsonian fusion, tandem fusion etc..), trasposizioni, adattamenti all’ambiente propri di certe specie (metaprogrammazione, borrowed information), endogenizzazione, simbiosi, processi Innovazione – Amplificazione – Divergenza, processi di Potenziamento – Attualizzazione – Perfezionamento etc..”interessano”, per così dire,il clima,i suoi cambiamenti e ciò che ne consegue…
      Tanto più se si va a fare un raffronto fra il tasso di variazione delle specie rispetto a quello dei cambiamenti climatico-ambientali che le avrebbero interessate durante l’evoluzione,dove per il nodarwinismo è tutto fuor che rose e fiori..compreso come normalmente si osserva il procedere di migrazioni-adattamenti-estinzioni.
      Cose che fanno anche capo al fatto che verificandosi di fatto spesso perdita di informazioni,se l’organismo può essere più adatto per il suo ambiente attuale, potrebbe aver perso la capacità di adattarsi ad altri ambienti,ovvero di fatto il cambiamento climatico incentiva la selezione,stimola attivazioni-de attivazioni di geni etc..nulla a che vedere con altre cose,e lì Enzo sinteticamente lo fa notare.
      Si può leggere anche:
      http://www.enzopennetta.it/2011/12/homo-sapiens-luomo-venuto-dal-nulla/

      Quindi :

      “chi però si avventurava anche oltre la foresta, che ormai era una zona estremamente contesa, aveva dei vantaggi. ”

      è una just so story che non vuol dir nulla,grossomodo si può dire che aveva svantaggi,ma poteva anche avere vantagg,si certo,ma è una storiella…
      Nulla di corroborato né falsificabile,nessuna osservazione empirica.
      Nulla di scientifico,saggistica,anche quel che segue.
      Si parla di un qualcosa di non falsificabile,di “invenzioni”, che fungono da spiegazioni, post-hoc per ogni nuovo fatto e/o per “tappare i buchi”.
      Storie mitologico-verosimili,racconti da Ovidio,da Kipling..
      A livello di fatti,a livello scientifico cosa resta?
      Nulla.

      • Chiedo scusa: come è già successo altre volte nei pochi commenti che ho postato finora, non si capisce il punto della mia obiezione, e quindi mi si dà una risposta che attacca in modo generico il darwinismo.

        Sono perfettamente consapevole che quella sulla scomparsa delle foreste è una just so story, non abbiamo neanche una teoria indiscussa su quale sia la causa principale del crollo dell’impero romano, figuriamoci andando così indietro.
        Siamo di fronte a due fenomeni documentati, l’evoluzione umana e i cambiamenti climatici, e ad ipotesi su quali siano i rapporti causa-effetto che eventualmente legano i vari aspetti di questi fenomeni concomitanti. Ecco cos’è una just so story.

        “È chiaro che alimentazione,interazioni fra specie,clima,quindi migrazioni,deriva genetica interessino lo sviluppo di una specie nel tempo,e questo,per quanto si può osservare a livello microevolutivo è anche ben documentato.”

        Ecco, è questo che volevo evidenziare. Il fatto che le specie si spostino non porta affatto a pensare che l’evoluzione non abbia come “motore” i cambiamenti climatici, e questo per due motivi:
        1) come ha detto Lei, Leonetto, è ben documentato che siano “motori” della microevoluzione.
        2) per quanto riguarda la macroevoluzione, osservare la migrazione e la resistenza delle specie all’estinzione è in accordo con le nostre just so stories (seppure non provi nulla).

        Quindi non comprendo in che modo “neghino un meccanismo evolutivo ampiamente accettato”.

        • Mmmm..non ha ‘afferrato’ tutto il mio discorso,ma si è ricondotto alla bontà del suo pensiero accettandone una parte..
          Oppure,ha riletto la frase di Enzo che “criticava”?Sicuro di averla compresa?
          Poi,in che modo l’evoluzione umana’ sarebbe un “fenomeno” “documentato”?

          Il punto 2 non vuol dire nulla,non nel senso che è irrilevante,ma proprio nel senso letterale.
          Poi le just so stories son create post-hoc,ci mancherebbe non fossero in “accordo” con certe cose..
          Tanto più che,come detto,il neodarwinismo ortodosso ha già accantonato quelle vecchie just so stories(per altre eh..),così che l’evento macroevolutivo determinante già c’era prima.

          Tanto più se si considera che quelle specifiche visioni,a cui Enzo scrive si può dire addio,prevedevano certamente una non migrazione nei termini in cui la riporta Enzo,appunto perché meccanismi epigenetici,i vari imprinting dati da clima,ambiente etc.. che potessero avere effetto e portare alla nuova funzione avrebbero richiesto una certa esposizione.

          Quindi non c’è verso che la vecchia visione possa avere ancora ad oggi bontà(sebbene spesso se ne trovi traccia,specie nelle riviste divulgative più commerciali),ma anche la nuova non è svincolata dai problemi della vecchia.

          Va detto altresì che se i pinguini ora fanno una cosa e altre specie ora fanno certe cose non vuol dire che specie passate abbian in certi casi fatto le medesime cose(anche se sarebbe lecito supporlo)o che non siano state impossibilitate a farlo.
          Certo,ma son storie..

          • No, a questo punto non sono più sicuro di aver compreso la frase di Pennetta.
            Esattamente quale sarebbe il meccanismo evolutivo ampiamente accettato che le osservazioni sui pinguini negano?

            Risposta alla seconda domanda: l’evoluzione umana è un fenomeno documentato nel senso che abbiamo i fossili che indicano che gli esemplari del genere homo in passato erano diversi, ma in qualche modo collegati a noi. Ma questo non si nega, vero?

        • Matteo lei dice “non comprendo in che modo “neghino un meccanismo evolutivo ampiamente accettato”.”

          Le riporto un brano tratto da un libro di scienze per i licei di cui ho parlato tempo fa in “Homo sapiens: l’uomo venuto dal nulla“:
          Circa dieci milioni di anni fa, una lunga fascia di territori orientali dell’Africa (dall’odierna Etiopia al Sudafrica) venne colpita da un clima piuttosto arido. I discendenti delle antiche scimmie dovettero adattarsi a fare a meno della foresta e a cercare il cibo nella savana. Così impararono a camminare sulle zampe posteriori in posizione eretta. La capacità di camminare con due gambe offrì il grandissimo vantaggio di liberare le mani per afferrare sassi e bastoni, o per portare ai propri piccoli il cibo raccolto.

          Ecco, questo è un meccanismo ampiamente accettato, se poi adesso si sta andando verso una limitazione di questo meccanismo alla microevoluzione simo tutti contenti.
          Ma resta la domanda: come avviene la macroevoluzione?

          • La limitazione è per quanto riguarda la nostra possibilità di ricostruire accuratamente la vicenda.

            Un classico esempio “micro” è il colore della Biston betularia, in cui possiamo per certo individuare i rapporti causa-effetto:
            – rivoluzione industriale -> inquinamento -> uccisione dei licheni sui tronchi -> cortecce più scure -> necessità di migliorare il mimetismo

            Non possiamo fare lo stesso quando si parla di periodi molto più lunghi e tempi molto antichi, e quindi ci accontentiamo delle just so stories, sulla base dei pochi indizi che abbiamo.

            Tuttavia essenzialmente non ci sono ragioni per ritenere che la macroevoluzione sia mossa da fenomeni diversi rispetto alla micro. Se piccoli cambiamenti ambientali in brevi tempi portano ad una distanza genetica X, fenotipicamente poco significativa, grandi cambiamenti ambientali in lunghi tempi possono portare ad una distanza genetica molto maggiore di X, quella tra due specie distinguibili anche con occhio distratto.
            Per giudicare se la distanza genetica è coerente, bisognerebbe fare un integrale rispetto al tempo della funzione che in ogni punto rappresenta il tasso di cambiamenti ambientali, e valutare il rapporto tra il caso osservato e il caso supposto. Sarebbe un calcolo tutt’altro che esauriente, le variabili in gioco sono molte di più, ma ci darebbe già un’idea di quale deve essere il peso dei cambiamenti ambientali nella spiegazione che dobbiamo cercare per la macroevoluzione.

          • La bison betularia come esempio di microevoluzione?
            Guardi che quello è solo uno spostamento nelle frequenze alleliche che solo la neolingua alla Pikaia può considerare come “evoluzione” micro o macro che sia.
            Poi lei afferma: “quando si parla di periodi molto più lunghi e tempi molto antichi, e quindi ci accontentiamo delle just so stories, sulla base dei pochi indizi che abbiamo.” bè, noi non ci accontentiamo.

            Per il resto abbiamo già parlato della nostra diversa valutazione sulla possibilità che la microevoluzione possa portare alla lunga alla macroevoluzione, quindi rimando all’articolo di Giuliani Revenui.

          • Buonasera Matteo,
            Benvenuto.
            Volevo aggiungere una cosa sulla micro/macro evoluzione.
            La scienza sperimentale non può dire nulla sul fatto che dalla prima derivi la seconda.
            È d’accordo?

            Saluti,

            Max

          • Beh Max matteo è chiaro..
            “Tuttavia essenzialmente non ci sono ragioni per ritenere che la macroevoluzione sia mossa da fenomeni diversi rispetto alla micro. ”

            Ma del resto quì è detto in modo esplicito:
            http://www.sma.unibo.it/erbario/c21.html

            “Molti autori sostengono che la macroevoluzione non è altro che lo sviluppo nel tempo della microevoluzione. Questa opinione è però confutata da altri.La teoria secondo la quale la macroevoluzione altro non è che la microevoluzione estesa nel tempo, e quindi i meccanismi che la spiegano sono i medesimi, viene chiamata “neo-darwinismo”, od anche “teoria sintetica dell’evoluzione.””

            e né il dott.Bellone:
            http://www.enzopennetta.it/2014/03/oltre-il-neodarwinismo-approfondimento-di-leonetto/#comment-24273
            né altri su quello sono”mai” intervenuti diversamente.
            Se non sprazzi come Eugene M. McCarthy(quello della macroevoluzione tramite ibridazioni “leggendarie”)che riconoscono il problema e la fallacità del neodarwinismo nello spiegare la macroevoluzione.Mi cito:
            “Dalla microevoluzione alla macroevoluzione,questo è senza dubbio un passaggio logico saltato, un cortocircuito neodarwinista.
            Il problema è che non si passa da una specie ad un’altra (e difficilissimamente anche da una sottospecie ad un’altra)se non con una permutazione simultanea di alcune centinaia di migliaia di ben posizionati nucleotidi ad altri altrettanto ben posizionati e tutto ciò, in una miriade di disposizioni con ripetizioni abortive.
            Cos’è che crea il nuovo e non semplicemente innova,rinnova,seleziona,mescola,rimescola,scambia etc?”
            Tutti i processi ricordati(in buona partec anche nel mio precedente commento:
            http://www.enzopennetta.it/2014/07/pinguini-negazionisti/#comment-28340
            Non hanno dato né danno corroborazione alcuna in favore di quel legame fra micro e macro evoluzione.

            Si può poi leggere ad esempio,come suggerisce Enzo:
            http://www.enzopennetta.it/2014/02/proprieta-emergenti-dellevoluzione-dei-geni-specie-come-attrattori-nello-spazio-fenotipico/

            E rimando anche al mio approfondimento:
            http://www.enzopennetta.it/2014/03/oltre-il-neodarwinismo-approfondimento-di-leonetto/

            Io non credo che ancora non sia chiaro quale sia l’oggetto della critica al neodarwinismo.

            Ci si accontenta di cosa?
            Di un dogma?di un credo?In scienza?
            No grazie,anche perché non dovrebbe essere così da 4-500 anni..
            “Nullius in verba”

            È una congettura per giunta non supportata da fatti quella che vuole che micro e macro siano legate da un fattore temporale.

          • @Max

            Io sono d’accordo che la scienza sperimentale non possa dire nulla sui dettagli di come sia avvenuta, cedendo l’onere alle ricostruzioni storiche, per loro natura imperfette. O ci si accontenta delle just so stories, sempre soggette a revisioni e ridiscussioni, o si introduce qualche dogma, non ci sono altre possibilità (salvo l’invenzione della macchina del tempo).

            Quello che la scienza sperimentale può dirci, e ci dirà col tempo, è se la macroevoluzione sia plausibile secondo i meccanismi attualmente noti oppure no.
            Ho parlato qui di una tipologia di esperimento che mette alla prova la teoria in tal senso:

            http://www.enzopennetta.it/2014/07/da-una-ricerca-su-nature-nuovi-dati-contro-la-sintesi-moderna/#comment-28128

            Ora mi appresto a leggere gli articoli proposti da Leonetto, e vedrò se la scienza sperimentale non ha già detto qualcosa contro.

          • Nell’attesa che il mio commento venga recuperato (sperando sia possibile), vorrei fare una precisazione di carattere generale, quello che a mio parere dev’essere un punto fermo da cui partire nel dibattito, ovvero:

            Siamo d’accordo che, dal punto di vista prettamente teorico, il neodarwinismo funziona perfettamente? Che se esistesse davvero questa catena di graduali mutazioni che collega diverse specie ad un antenato comune passando sempre per forme funzionali, posta la giusta pressione selettiva sarebbe molto probabile che si verifichi quel percorso evolutivo (od altri possibili, che si presumono essere parecchi) per semplice selezione cumulativa?

            Per fissare le idee propongo un esempio astratto. Prendiamo questo bruco: ATGCTGTTGCCGCGCTAACG
            Esso possiede 20 caratteri (in tutti i sensi). Supponiamo per semplicità un rapporto lineare tra genotipo e fenotipo, anche se non sarebbe strettamente necessario, e supponiamo che questo bruco, potendo scegliere tra migliaia di foglie diverse, si posi su di una la cui superficie è rappresentata da un tappeto di lettere T.

            Quanti eventi di singola mutazione sono necessarie per rendere il bruco perfettamente mimetico, in modo da salvarsi dai predatori?

            Creazionismo: 0
            Dio ha creato il bruco già perfettamente adatto, secondo il Suo piano divino.

            Intelligent Design: 20
            Ad ogni generazione, una forza divina/mistica ha introdotto sempre la mutazione giusta, quella T, nella posizione giusta (quella dove non c’è ancora una T).

            Mterialismo dell’antica Grecia (ripreso nel De Rerum Natura di Lucrezio): 4^20
            Tutte le combinazioni dei 4 amminoacidi/lettere sono state provate a caso finché non si è giunti al nostro mondo, in cui tutto funziona.
            Si tratta di un numero di tentativi dell’ordine di 10^12, tutti noi possiamo concordare che è eccessivo per una sequenza breve.

            Neodarwinismo: tra 400 e 8000
            Esiste un teorema, dimostrato dal matematico e metabiologo Gregory Chaitin, che ha questo risultato. Per selezione cumulativa, ci si aspetta che con massima probabilità sia sufficiente un numero di mutazioni compreso tra N^2 ed N^3

            Da notare che la spiegazione neodarwiniana offre un risultato molto più vicino all’ID che non al mondo “a forza bruta”, dove si provano tutte le strade possibili. A livello computazionale e sperimentale (solo per quanto riguarda la microevoluzione) si è dimostrato che questo sistema di mutazione e selezione porta i risultati descritti nei tempi attesi.

          • Giorgio Masiero on

            @ Matteo
            Sono sinceramente stupito.

            1. Lei considera neodarwinismo il “teorema” di Chaitin, che invece, nelle parole dell’autore, e’ l’opposto! Il neodarwinismo si affida meramente al caso, all’ergodicita’, per produrre le mutazioni, ESATTAMENTE come nel De rerum natura e nel materialismo greco, e quindi – scrive Chaitin – e’ completamente fuori della fisica!

            2. Che fa il matematico Chaitin? In parole semplici, mette IN PRINCIPIO un selettore matematico che filtri da tutte le combinazioni a priori possibili quel sottoinsieme “connesso” sufficiente a numerare tutta la decina di milioni di specie secondo stringhe astratte (non genetiche) evolvibili nei tempi fisici dell’Universo. Un giochetto matematico, una “metabiologia religiosa” (Chaitin), che vorrebbe descrivere il modo di operare di Dio.

            3. Dawkins aveva provato ad addomesticare il caso, ma era caduto nell’ID, perche’ il suo programma aveva una stringa “obiettivo”. Chaitin ha una metafisica vicina a Leibniz, Spinoza e Goedel (come quasi tutti i matematici) e non nasconde la sua religiosità. Ma questa e’ scienza?

            4. Perché la microevoluzione non sia la somma di micro, trovera’, Matteo, la dimostrazione matematica in un mio commento all’articolo di oggi in headline.

          • Chaitin, come molti matematici teorici, non si preoccupa di tenere i piedi per terra e il suo intento è quello di creare un modello di evoluzione il più astratto possibile. Si preoccupa solo dell’eleganza concettuale, e quindi per lui la pura astrazione è motivo di vanto.

            Tuttavia, come accade molto spesso, le elucubrazioni matematiche si prestano volentieri ad applicazioni (magari ai matematici puri dà pure fastidio!) ed ecco che con il mio semplice esempio ci si avvicina un po’ di più alla biologia terreste.

            Il selettore matematico diventa semplicemente l’uccello che preda il bruco.

            La frase-obiettivo di Dawkins viene sostituita da una stringa di caratteri che può corrispondere ad esempio al colore dei 20 segmenti dell’ipotetico bruco. In questo modo risulta più chiara e non fraintendibile la distanza dall’ID. Se il bruco si fosse posato su una foglia che raffigura questo motivo: “ACACATATACACATAT…”, l’evoluzione sarebbe stata diversa. Allo stesso modo se il bruco dovesse alternare la sua posizione tra più foglie. Nessuna sequenza obiettivo, bensì infinite possibilità dettate dalla contingenza ambientale. Solo nell’ipotesi di staticità di tutti i fattori non genetici si ha l’illusione della ricerca di un obiettivo, che serve solo a semplificare la spiegazione, ma che in natura non esiste e di cui si potrebbe fare a meno senza perdere generalità.

          • Giorgio Masiero on

            Non facciamo confusioni, Matteo. Nel darwinismo l’unica, dico unica, fonte di novita’ e’ il caso: una micromutazione avviene la’ per un raggio cosmico, li per un errore di copiatura, ecc. La selezione naturale, DOPO, conserva cio’ che si adatta meglio e si moltiplica di piu’.

            Darwinismo = De rerum natura + selezione naturale.
            Chaitin e’ neoplatonismo, un esercizio matematico di ID.

            Chaitin e’ matematica pura, non biologia.
            Il darwinismo (e il materialismo greco) sono contro la fisica perché “non c’e’ stato abbastanza tempo” (Kauffman).

          • Quindi se prendo per buona la Sua distinzione, Masiero, dovrei concludere che anche lo stesso Chaitin ha idee confuse sulla sua posizione, in quanto distingue ID, mondo a forza bruta (De rerum natura), darwinismo proprio in base alla complessità dell’algoritmo con cui attuano l’evoluzione: L’ID ha una complessità N, ed il perché è intuitivo (ad ogni passo si sceglie la mutazione che deve avvenire prevedendo la funzione che avrà, quindi bastano N passi), il mondo a forza bruta prova tutte le combinazioni possibili e quindi ha naturalmente una complessità di a^N (dove a è la base del sistema di numerazione).

            Ora, ammettendo io l’errore nell’affidarmi per pigrizia alla mente di qualcun altro, propongo quindi di dimenticarci di Chaitin e ricalcolare insieme la complessità dell’algoritmo di selezione cumulativa, che è ben diversa dall’ID poiché la mutazione è casuale e non progettata, ed è ben diversa dalla forza bruta perché non prova tutte le strade possibili (a differenza del caso che non ha memoria, qui c’è la memoria data dall’ereditarietà, e l’accumulo di mutazioni è guidato dalla selezione).

            Il darwinismo è questo, e chiaramente ha una complessità superlineare e subesponenziale. Prima di provare a fare il conto, vorrei che si riconoscesse questo, altrimenti è inutile.

          • Matteo, ma non si accorge che i suoi ragionamenti valgono solo per la microevoluzione?
            Giriamo sempre intorno alla stessa cosa!
            Lei afferma: “la complessità dell’algoritmo di selezione cumulativa, che è ben diversa dall’ID poiché la mutazione è casuale e non progettata, ed è ben diversa dalla forza bruta perché non prova tutte le strade possibili (a differenza del caso che non ha memoria, qui c’è la memoria data dall’ereditarietà, e l’accumulo di mutazioni è guidato dalla selezione).”
            La memoria dell’ereditarietà vale per una funzione operante non per una che è da venire. Come faccio a memorizzare una mutazione se non è ancora selezionabile per una determinata funzione?
            Per questo motivo è stata tirata fuori la questione dell’exaptation, che però non è verificabile (chi può farmi la storia della formazione dell’emoglobina dalla sua funzione originale ipotizzata a quella attuale?) e quindi si tratta ancora di una congettura non scientifica che serve solo a rattoppare la teoria.

          • Beh Enzo come giustamente fai notare si ricade in cose già dette,linkate e scritte anche nel corso di questo stesso scambio di commenti.
            Non aggiungo nulla a quanto hai scritto e rimando quindi a ciò che già è stato scritto,però faccio notare anche un’altra cosa..

            Matteo,l’ID citato da Masiero stà a significare il fatto che sia presente un progetto,ossia un sistema per giungere all’obiettivo.
            Ebbene è impossibile dire sulla complessità ed il numero di passi a prescindere.
            Prendiamo il ‘weasel’ di Dawkins.
            Già lo stesso algoritmo può produrre la frase obiettivo dopo un numero diverso di passi..
            Ma poi posso fare un algoritmo che ‘salvi una lettera’ se questa salta fuori nella posizione corretta,ed allora ad ogni passo posso avere salvate da 0 a z(numero lettere della frase biettivo)lettere;posso far sì che prima si salvi la M in prima posizione(anche se ci fossero altre lettere in posizione),poi ‘e’ e così via…
            Poi posso fare che se dopo tot passi non ci siano x lettere in posizione corretta si resetti tutto.
            Posso far sì che si dsalvi una lettera presente nella frase obiettivo anche in posizione sbagliata e poi quando escon tutte rimescolare fino alla frase obiettivo,etc etc..
            Dipende dall’algoritmo.
            La cosa importante è che c’è una frase obiettivo e viene dato un sistema per arrivarci.

            È irrilevante per la discussione,ma è comunque sbagliato.

          • @Enzo Pennetta

            Il mio scopo finora è stato solo quello di evidenziare che in teoria, mantenendo un certo livello di astrazione, il darwinismo funziona bene ed è compatibile con i tempi dell’universo, cioé non ci sono ragioni logiche o matematiche che, a prescindere dai risultati sperimentali, ci portino già a valutare molto bassa la probabilità che le mutazioni casuali e la selezione cumulativa da sole abbiano portato alla complessità che osserviamo oggi.

            Altra questione è se ciò sia possibile in pratica. Se ne è discusso nell’articolo che riporta lo studio sul recettore del cortisolo, che da un lato dimostra in un caso particolare che una sequenza di proteine sempre funzionali esiste fino a risalire a mezzo miliardo di anni fa, da un altro dimostra che non è tutto così semplice come nel mondo ideale di Dawkins o nel mio esempio del bruco.

            Un altro evidente problema con cui ci si scontra per questa via è appunto la necessità logica per cui gli antenati più primitivi delle attuali proteine dovessero per forza avere una funzione differente da quella odierna, visto che si trovavano in organismi unicellulari. Quindi, come da Lei evidenziato, si dovrebbe discutere proprio sull’exattamento, e sui numerosi studi a riguardo, cito un esempio:

            http://www.pikaia.eu/EasyNe2/Notizie/Scoperto_un_preadattamento_biochimico_nelle_proteine_G.aspx

            “Lo studio di Kuang e colleghi e’ l’ennesima dimostrazione di come strutture e cicli metabolici estremamente complessi, come il sistema dei recettori del glutammato fondamentale nel sistema nervoso dei mammiferi, possono spesso avere origine da strutture e cicli preesistenti richiedendo solo dei cambiamenti minimi nel DNA dei geni coinvolti.”

            Ma prima di ciò, credo che sia prioritario intendersi sulla teoria.

          • Quelle conclusioni dell’articolista di Pikaia non rispecchiano molto la veridicità di ciò che dice quello studio..

  4. Il Luglio più fresco di cui abbia memoria. Alla faccia del riscaldamento!

    Mi chiedo quanto possa essere credibile una teoria che slitta continuamente le sue previsioni. I sostenitori del GW mi sembrano sempre più simili a quelli che professano la veridicità delle varie date apocalittiche.

    • A pensarci bene effettivamente sono un po’ come i testimoni di Geova, gli manca solo di venire a suonarti alla porta per convincerti dell’AGW e venderti un libro di Al Gore…

  5. Giorgio Masiero on

    @ Matteo
    Lei non finisce di stupire.
    Prima chiama neo-darwinismo un modello astratto matematico di Chaitin, dichiaratamente metabiologico (cioè metafisico, non scientifico), basato su una concezione platonica, avente una serie di assiomi nessuno dei quali rientra nella Sintesi moderna e che sta alla vita reale studiata dai biologi come il gioco del Monòpoli sta all’economia reale studiata dagli economisti.
    E adesso, di fronte all’impotenza del “caso” a creare la complessità della vita nei tempi fisici dell’Universo, Lei tira in ballo la “selezione cumulativa”!

    Certamente, se c’è stata evoluzione (come tutti ipotizziamo ragionevolmente), Lei ed io ed ogni altro organismo vivente siamo il risultato di una selezione cumulativa efficace di mutazioni genetiche. Ma come si è arrivati a questo cumulo? Per “caso”, attraverso la somma di tante micromutazioni (neodarwinismo) o per “salti” attraverso l’azione del campo elettromagnetico (strutturalismo fisico)?
    Anche trascurando il fatto – che Lei continua ad ignorare – che già tra due specie di topo le sequenze sono topologicamente isolate (sicché non si può arrivare al DNA di una specie da quello dell’altra per singole micromutazioni), comunque non si può pensare di addomesticare il caso con la selezione naturale (come ha pensato quel genio di Dawkins, facendo poi marcia indietro): sul legame fosfodiesterico infatti, un effetto della selezione naturale è impossibile, perché la selezione agisce solo dopo l’accadimento della mutazione, sui fenotipi già sintetizzati, e non sui genotipi!

    Quindi, le micromutazioni contingenti che il neodarwinismo ipotizza per spiegare l’evoluzione non sono la spiegazione giusta perché:
    1) La macroevoluzione non può essere matematicamente la somma di microevoluzioni;
    2) Non c’è stato tempo sufficiente in tutto l’Universo per dare ad un caso senza memoria la possibilità di esplorare tutte le possibilità, da far poi filtrare alla selezione.

    Chi introduce una memoria nel caso a livello di genotipo lo trasforma in ID, perché sostituisce la selezione naturale col Programmatore intelligente.

    • @Giorgio Masiero

      E’ chiaro che Lei ha conoscenze che mi sfuggono.

      “già tra due specie di topo le sequenze sono topologicamente isolate (sicché non si può arrivare al DNA di una specie da quello dell’altra per singole micromutazioni)”

      Esiste uno studio che dimostra che sono topologicamente isolate? E secondo quale criterio? Per contro ci sono degli studi che trovano catene di proteine sempre funzionali fino a risalire a tempi molto remoti. Chi ha ragione?

      “Ma come si è arrivati a questo cumulo? Per “caso”, attraverso la somma di tante micromutazioni (neodarwinismo) o per “salti” attraverso l’azione del campo elettromagnetico (strutturalismo fisico)?”

      Ho letto i Suoi articoli in cui si parla della funzione biologica dei campi elettromagnetici, e credo sia plausibile per quanto riguarda le reazioni metaboliche e tutto il resto, ma ho delle perplessità riguardo alle mutazioni. Si è mai osservata una mutazione genetica indotta in modo “deliberato”, ovvero non riconducibile al semplice malfunzionamento di qualche altro processo, ma frutto di un processo specifico, sistematico? Perché se così fosse, ammetto che sarebbe più semplice spiegare i fenomeni di evoluzione.

      • “Esiste uno studio che dimostra che sono topologicamente isolate? E secondo quale criterio? Per contro ci sono degli studi che trovano catene di proteine sempre funzionali fino a risalire a tempi molto remoti. Chi ha ragione?”

        Lei sa come sono fatti i secondi studi che cita?
        Credo di no.
        Sul primo invece le ne è stato fatto un esempio circa tre-quattro volte..(quello dei topi) si va poi ad inquadrare quello che è il “fenotipo discreto”.
        Un commento di uno degli autori di quella review:
        http://www.enzopennetta.it/2014/03/oltre-il-neodarwinismo-approfondimento-di-leonetto/#comment-24279

        Ora,come ho fatto anche notare:

        http://www.enzopennetta.it/2014/02/proprieta-emergenti-dellevoluzione-dei-geni-specie-come-attrattori-nello-spazio-fenotipico/#comment-23726
        (consiglio di leggere anche l’articolo)

        anche in base a cose come:
        http://www.derattizzazione-disinfestazione.it/blog/2012/01/16/topi-ibridi-sviluppano-resistenza-al-veleno/

        O le due specie sono in realtà varietà di un’unica popolazione archetipo.E allora ok,ma siamo in microevoluzione..

        Oppure le due specie,pur anche avendo antenato,ma hanno sviluppato caratteristiche nuove e diverse ed allora ciò è impossibile che sia avvenuto come somma di microevoluzioni.

        Tertium non datur.

        Valgono comunque sempre tutte le considerazioni fatta dall’inizio sino a quì,le consiglio di rileggersele.

      • Giorgio Masiero on

        Che ci siano proteine comuni, Matteo, non prova che lo spazio delle configurazioni genetiche sia topologicamente connesso. La dimostrazione matematica dell’isolamento e’ data – Glielo ripeto – nel paper citato nel mio commento all’articolo oggi in headline.

        NB. Che la microevoluzione sia necessariamente guidata da un campo elettromagnetico e’ conseguenza dei motivi che ho spiegato negli articoli “La vita e’ fisica”. In poche parole, perche’ solo un campo puo’ fare da driver ad un fenomeno localmente antientropico come la vita e perché gli altri campi della fisica non hanno il range. Se conoscessimo il preciso meccanismo usato dal campo e.m. nel suo entanglement con la biochimica, avremmo fatto la piu’ grande scoperta scientifica di tutti i tempi: abiogenesi ed evoluzione in un colpo solo! Purtroppo, finche’ la maggioranza degli studiosi penserà che il problema e’ già stato risolto col darwinismo e si metterà il cuore in pace con l’ignoranza, o stara’ alla larga da questo tipo di studi per non mettersi pericolosamente contro il mainstream, la ricerca di quel meccanismo procederà a rilento, con le poche risorse disponibili.

        • Ho capito, quella sul campo elettromagnetico è un’ipotesi scientifica e controllabile, ma non ancora “controllata”. A mio parere per la macroevoluzione neodarwinista è lo stesso, ho spiegato come si può confutare con esperimenti complessi e successivi calcoli probabilistici, ma a quanto pare voi avete in mano qualcos’altro che potrebbe già essere sufficiente.

          Sono molto curioso di sapere come un solo esperimento o due possano decretare l’impossibilità (o meglio la scarsa probabilità) della macroevoluzione per via neodarwiniana, speravo me lo poteste spiegare in parole semplici, ma a quanto pare è necessario studiare direttamente gli articoli.

          Dunque non commenterò più senza prima essermi documentato delle vostre fonti, se nel frattempo avete altro da aggiungere sempre riguardo questi studi, lo leggerò volentieri

          • Giorgio Masiero on

            No, Matteo.
            1. Il darwinismo non è confutabile. Proprio per questo non è una teoria scientifica. V. http://www.enzopennetta.it/2013/08/sulla-falsificabilita-o-corroborabilita-del-darwinismo/
            2. La proposta del campo e.m. come driver dei cicli biologici è stata ampiamente corroborata. V. http://www.enzopennetta.it/2014/05/la-vita-e-fisica-parte-iii/ , paragrafo ‘Prime corroborazioni e applicazioni’
            3. Non è “un esperimento o due” a confutare la congettura della macroevoluzione come somma di microevoluzioni, ma di una dimostrazione matematica (effettuata applicando una PCA sui dati di deep sequencing del genoma di topo provenienti dal Sanger Institute) che lo spazio delle configurazioni genetiche di due specie dello stesso genere non è connesso. Ne riparliamo eventualmente dopo che ha studiato l’articolo.

          • @Giorgio Masiero

            1 – Come ho letto su questo sito, il darwinismo (a vostro parere) pretenderebbe il susseguirsi di fenomeni improbabili ma possibili, ciò nonostante, per definizione, una possibilità può sempre accadere, quindi non si può dimostrare che non sia accaduta. D’accordo, ma se la probabilità diventa troppo bassa, il valore di verità dell’ipotesi viene considerato nullo. La scienza non segue la concezione matematica secondo cui una proposizione o è certamente vera, o è certamente falsa, oppure non ci è dato a sapere e potrebbe essere entrambe.
            2 – Questo l’ho colto ed è una grande scoperta, la mia perplessità è sul fatto che possa essere driver delle mutazioni genetiche.
            3 – E questo non significa concordare che un modo per confutare il darwinismo esiste? Ne riparleremo appena ho il tempo di approfondire.

          • Giorgio Masiero on

            @ Matteo
            1. Il darwinismo non è falsificabile perché non fa predizioni sperimentalmente controllabili. Punto. Se non è d’accordo, mi dica, Matteo, una predizione fatta dal darwinismo in 150 anni.
            2. Intendevo dire che il c.e.m. ha fatto molte predizioni corroborate, a partire dalla spiegazione dei 4 “misteri” della biologia molecolare di cui parlo in “La vita è fisica, Parte I”. Sono d’accordo con Lei che abbiamo ancora molta strada da fare, prima di spiegare l’abiogenesi e l’evoluzione. Ma non trova sorprendente che la maggior parte dei biologi (e Lei è uno di questi, e abbastanza preparato per quanto posso capire) neanche conosca la TQC e la fisica moderna applicata alla biologia, ed invece siano fermi al meccanicismo ottocentesco?
            3. Lo studio smentisce che la macro sia somma di tante micro, ma non che un DNA (di Mus spretus) sia evoluto da un altro DNA (di Mus musculus) PER UN SALTO CASUALE attraverso lo scambio contemporaneo di molti tratti genetici contemporanei, tipo i giochini di Chaitin! Così come il darwinismo ha inventato l’exaptation (infalsificabile!!) per spiegare un fenomeno che la selezione non spiega, può sempre dire che questo evento di evoluzione tra i DNA di due specie dello stesso genere Mus seppure improbabilissimo è possibile! No, Matteo, ricorrendo al caso onnipotente, il darwinismo non è confutabile, alla pari del creazionismo che ricorre a Dio!

          • @Giorgio Masiero

            Da un lato sta affermando che è possibile dimostrare sperimentalmente (e anzi sarebbe già stato dimostrato) che il neodarwinismo richiede eventi “improbabilissimi”, da un lato non riconsce che in scienza “improbabilissimo” = falso = impossibile. A differenza di quanto potrebbe fare il matematico o il filosofo, lo scienziato ignora e rifiuta tutto quello che sta sotto una ragionevole soglia di probabilità. O potremmo dire che, seppure con bassa probabilità, gli unicorni esistono, oppure che esiste un complotto mondiale che coinvolge migliaia e migliaia di persone e da anni viene tenuto nascosto con successo. E magari dovremmo eliminare dal commercio praticamente qualunque prodotto per via dell’impossibilità scientifica di determinare con probabilità 1/1 la sua sicurezza, etc, etc.

            Ma qui su CS si critica l’evoluzione studiata dai biologi o qualche esotica versione metafisica del neodarwinismo (come quella che ho letto una volta che coinvolge i multiversi e cose del genere)? Se è la seconda sono d’accordo. Ma inutile nascondere ai lettori che esiste il darwinismo scientifico, e il fatto che sia scientifico si comprende anche da quanto è cambiato alla luce delle nuove prove, tanto che a distanza di 150 anni c’è chi propone di eliminare del tutto il nome di Darwin da quello dell’attuale teoria.

            Per finire, ecco un esempio di applicazione tecnologica della teoria dell’evoluzione:
            http://www.pikaia.eu/EasyNe2/Notizie/Le_regole_dell%E2%80%99evoluzione.aspx?fb_action_ids=10200136901571646&fb_action_types=og.likes&fb_source=aggregation&fb_aggregation_id=288381481237582

            La sua utilità, per i parassiti come per i batteri, è soprattutto un “know your enemy”.

          • Matteo, se lei vuole confondere la selezione, che oltretutto è un’ovvietà conosciuta da sempre, con l’evoluzione, cioè con i meccanismi con i quali compaiono nuove specie, abbiamo davvero speso inutilmente fiumi di parole.
            L’articolo da lei segnalato dice in qualche punto come compaiano nuovi caratteri?
            No, è solo un ‘gioco’ di selezione, mutatis mutandis la stessa che facevano gli allevatori di piccioni studiati da Darwin mentre cercava di fare la sua teoria, e proprio per questo non è la teoria dell’evoluzione che permette questi metodi (come erroneamente afferma l’articolo su Pikaia) ma la selezione e le leggi di Mendel!

          • Giorgio Masiero on

            Grazie, Enzo. Senza leggere l’articolo di Pikaia, conoscendo i nostri polli, avevo dubitato che si trattasse di evoluzione – avendo appreso da CS che non abbiamo ancora avuto come umani la fortuna di assistere ad un vero evento macroevolutivo – e perciò avevo usato con Matteo la premessa “ammesso che si tratti di evoluzione…”. E mi ero concentrato sull’aspetto epistemologico di distinguere comunque tra evoluzione e sua spiegazione.
            Ora apprendo da te che addirittura si spaccia per darwinismo un fenomeno mendeliano…

            Ma questi ci sono o ci fanno?!

          • Secondo me ormai sono così condizionati che non si accorgono più delle contraddizioni, a partire dagli autori dello studio pubblicato su Nature per finire con Mandrioli autore dell’articolo su Pikaia,il passaggio chiave di tutti gli articoli sulla ‘comparsa’ di ceppi resistenti (vedi batteri e antibiotici) è sempre lo stesso, come quello seguente preso dall’articolo su Pikaia:
            ” tutte le volte che viene introdotto un agente di selezione contro una data specie, essa reagirà cercando di evolvere forme di resistenza. L’introduzione di piante che producono tossine Bt non può quindi che comportare la comparsa di insetti resistenti a tali tossine”

            Innanzitutto vediamo un gravissimo utilizzo del termine “cercare” che propone addirittura un’evoluzione finalistica!
            Poi segnalo un ambiguo impiego del termine “comparsa” che lascia intender che ci troviamo di fronte a un carattere del tutto assente nella popolazione iniziale mentre si tratta evidentemente di un gene presente in piccole percentuali.

            Il metodo descritto si gioca poi sulla presenza di individui omozigoti (resistenti all’insetticida) e eterozigoti (non resistenti) che vengono incentivati con incroci, quindi siamo nella più classica e pura genetica mendeliana, il darwinismo non c’entra proprio niente.

          • Giorgio Masiero on

            Quindi, Enzo, “ci sono”. Poveretti, vittime della nemesi di una filosofia che
            – da un lato, considera la comparsa della ragione umana come risultato del caso e “senza direzione di progresso”;
            – dall’altro pretende di usare questa ragione “senza senso” per insegnarci ex cathedra come stanno le cose!
            Ma non gli viene mai in testa un piccolo dubbio (di Darwin)?!

          • Forse, ma è quel genere di dubbi che non giova alla carriera.
            La prova continuata nel tempo la danno personaggi come il citato Sermonti e più recentemente P.Palmarini che si è preso una bordata di critiche per il suo libro, per fortuna la carriera l’aveva fatta prima.

          • Che bello Matteo,non ha recepito una parola di quelle che le sono state scritte o a cui è stato rimandato…
            Davvero Matteo?
            Applicazione tecnologica ottenuta grazie al neodarwinismo?
            Come detto,invano,nessuno nega tutti i processi microevolutivi e neanche che il neodarwinismo possa essere una teoria utilizzabile per spiegarli.
            Ma poi..la selezione naturale?
            Alcune applicazioni in campo di zootecnica e agricoltura,così come alcune ricadute dovute a qualche accadimento eran già risapute ante Darwin e non necessitano neanche del darwinismo.
            Un articolo poi dove viene scritto:
            “L’introduzione di piante che producono tossine Bt non può quindi che comportare la comparsa di insetti resistenti a tali tossine.”
            E sì che le avevo detto di valutare gli articoli di Pikaia con un occhio critico..invece nulla..
            Questa è disinformazione,è una baggianata..
            Se ci sono,allora ‘compaiono'(o attivando meccanismi di adattamento propri della specie in risposta allo stimolo o banalmente rimangono i più adatti della popolazione che poi generano popolazione di più adatti..).
            Detta così poi è palesemente un finalismo..ma scherziamo?
            È del tutto analogo alle resistenze agli antibiotici,agli antiparssitari,ai ‘veleni’ per topi…è evoluzione?
            No selezione.
            O comunque in generale microevoluzione,adattamento.
            Non è quello l’oggetto di critica al neodarwinismo,l’anbbiamo detto e ridetto,ma non che non sia quello ciò che viene criticato quì non è criticato a livello mondiale..
            Le è stato spiegato anche che esiste una differenza fra il fatto dell’evoluzione,la congettura ragionevole dell’evoluzione e la teoria sull’evoluzione.
            Invece nulla..

            Per fortuna s’è preso anche una pausa per organizzare un pensiero sulla questione..

            Grazie comunque per aver permesso di mostrare un altro articolo di Pikaia in cui si passan lucciole per lanterne…

          • Certo, qui si parla di studi sulla microevoluzione, ma non si possono ricondurre semplicemente alle leggi di Mendel, bensì necessitano proprio dell’approccio integrato della sintesi moderna, a meno di postulare la non introduzione di nuove varianti dei geni, ma questa ipotesi può nutrire false speranze e portare a credere che sia possibile progettare un pesticida con efficacia definitiva su tutti gli insetti della specie interessata.
            Sul campo si è osservato che la risposta della popolazione di insetti è quella di evolvere sempre una forma di resistenza ai nuovi pesticidi, l’unica cosa su cui si può avere un controllo è la rapidità con cui questo avviene. Sequenziando il DNA si è visto che ci sono effettivamente delle mutazioni nei geni coinvolti: difficile credere che tutte le varianti alleliche, che a seconda della pressione selettiva diventano dominanti, fossero già preesistenti (ovvero, dopo la mutazione casuale, abbiano finito per fissarsi in qualche sottopopolazione per puro caso, prima ancora che i vari pesticidi fossero inventati, solo se la mutazione casuale avviene durante il processo selettivo allora viene selezionata positivamente).

          • Appunto Matteo,come detto non riguarda per nulla la critica al neodarwinismo,né fornisce alcuna prova,corroborazione o applicazione tecnologica.
            Anche circa la gestione della resaistenza di batteri ,insetti od altro alla fine è estranea alla Sintesi.
            http://www.annualreviews.org/doi/abs/10.1146/annurev.ento.45.1.371
            E comuqnue non riguarda certo il punto fondamentale,la nascita di genuina nuova informazione…
            Se si osserva la letteratura relativa ai casi di resistenza a antibiotici e pesticidi si osserva che nella maggior parte dei casi questa nn è dovuta a mutazioni, ma in quasi tutti i casi sono il risultato di complessi sistemi di difesa di integrazione genetica e biologia molecolare.E quei pochi esempi che invece sono dovuti a mutazioni sono causa di mutazioni che di fatto portano una perdita di infotrmazione e nessuna nuova informazione..
            Per esempio con il DDT il sistema nervoso dell’insetto non era(è) più in grado di funzionare correttamente portando alla morte dell’insetto Qualsiasi mutazione che influenzava(a) negativamente il legame del DDT alla cellula nervosa, se non è letale o quasi letale, ha il potenziale di conferire resistenza DDT all’insetto.
            Tutto perfettamente spiegabile appunto con selezione e leggi di Mendel.
            Quindi sì quanto detto è corretto..
            E con il Bt sono applicazioni di bio-ingegneria genetica..non c’entra il neodarwinismo,sono indipendenti in verità da questo e comunque sempre non riguardano altro che microevoluzione..
            Individuato il gene che produce le proteine ​​Bt letali per gli insetti in questione si va a trasferire il gene in piante coltivate.
            Va da sé che se avviene qualcosa di analogo al DDT la variente che resiste si riproduce e presto l’intera popolazione diventa formata da tali individui..
            Non vedo ciò cosa c’entri con tutto quanto si è detto..

          • E’ vero, sistemi di difesa generici che l’insetto ha evoluto di solito vanno più che bene, spesso le mutazioni li potenziano solo, magari a spesa dell’efficienza di altri aspetti. Oppure avvengono delle mutazioni nei siti attivi che legano le sostanze tossiche introdotte.

            A livello informatico, qualunque nuova mutazione porta a nuova informazione, poi a livello non scientifico ognuno può interpretare come meglio crede. Per una legge ingegneristica, non esiste un organismo che possa fare tutto meglio degli altri, quindi anche a livello di macroevoluzione possiamo interpretare un percorso evolutivo come perdita di funzione/informazione, ad esempio l’uomo ha perso la prensilità nei piedi e non riesce più ad arrampicarsi sugli alberi, poi il cranio umano è più semplice perché ha perso alcune fasi dello sviluppo che lo rendevano più prognato. Per arrivare a tempi più recenti, anche il gene che permette di digerire il lattosio è un vantaggio dovuto alla rottura di un precedente meccanismo di regolazione. Per contro, anche un meccanismo di regolazione può essere visto come una selezione di vecchie funzioni e non la nascita di una nuova funzione. Anche quando le macchine molecolari aumentano la loro complessità si può vedere come una perdita di funzione: una proteina che sapeva fare due cose si scinde in due proteine con funzioni specifiche, una semplice specializzazione.

            Oppure tutto quello che ho detto si può reinterpretare come acquisizione di nuove funzioni, sta a noi.

          • Ma assolutamente no Matteo,non faccia confusione e tenga conto delle cose già dette,è banale come il concetto di “nuova informazione” non vada in questo caso inteso in termini puramente sintattici(Shannon).
            Inoltre ,ancora ci si ritrova a ripeterlo(stan diventando troppe..)se perdo qualcosa e ottengo un vantaggio adattivo per qualche ragione non si va oltre la microevoluzione.
            Ma queste cose le sono già state dette,se le ripete girando intorno al problema non è che risolva qualcosa..
            Sorvoliamo sulle “leggi ingegneristiche” e la cosa dell’organismo che può fare tutto meglio degli altri,che veramente non c’entra nulla,ma nulla proprio..
            Al di là che cose come il latte e la pastorizia 10000 anni fa sono comunque un po’ just so stories,ma lasciando perdere questo, la mutazione che conferisce persistenza della lattasi nei nordeuropei è diversa dalla mutazione per gli orientali e africani che sono lattasi persistenti.
            Questa non è però “evoluzione convergente”,è solo un gioco di termini,c’è stata perdita di informazione ,cioè, il normale meccanismo di spegnimento della produzione di lattasi seguente allo svezzamento è stato disattivato,ma nella migliore delle ipotesi è selezione.
            Un esempio perfetto per testi didattici di selezione.Non è comparso nulla di nuovo.
            Non è che digeriscon la cellulosa(.cit),il latte lo digerivano già,fino allo svezzamento,in alcuni l'”interuttore” in un modo o nell’altro non viene premuto e non si spegne la funzione..
            Volendo è “analogo” al caso dei batteri di Lenski..
            Ma dove è stato negato che meccanismi microevolutivi possono conferire adattamento?
            Guardi che continua a girare intorno alla solita cosa eh..
            A forza di perdita di funzioni si va verso l’estinzione non verso la formazione di una “nuova specie”
            La rimando ancora ad una lettura di:
            http://www.enzopennetta.it/2013/08/sulla-falsificabilita-o-corroborabilita-del-darwinismo/
            http://www.enzopennetta.it/2014/03/oltre-il-neodarwinismo-approfondimento-di-leonetto/

            E poi seguo il prof.Masiero.

  6. Giorgio Masiero on

    @ Matteo
    1. Perché i darwinisti credano ad accadimenti da loro stessi giudicati “improbabilissimi, impossibili da replicare artificialmente” (Crick), “colpi alla roulette doppi… forse unici nell’universo” (Monod), “fuori dello spazio delle configurazioni possibili” (Kauffman), Lei dovrebbe chiederlo a loro o interrogare Se stesso. Noi non ci stanchiamo di denunciare al Cicap questa superstizione, ma non abbiamo mai avuto risposta. Noi inoltre, siccome rispettiamo comunque coloro che credono nei miracoli, riconosciamo che cio’ che e’ improbabile non e’ impossibile, e ci accontentiamo popperianamente di dire che il darwinismo non e’ scientifico perché non e’ falsificabile.

    2. E infatti Lei non mi ha proposto, come Le avevo chiesto, una sola predizione darwinistica in 150 anni, che si possa corroborare o falsificare. L’articolo di Pikaia che mi propone – ammesso che si basi sull’evoluzione, cosa che qui nessuno ha mai messo in discussione! – non ha nulla a che fare con la spiegazione darwiniana dell’evoluzione, cioè con la congettura che la presunta evoluzione batterica sia avvenuta “per caso”, piuttosto che per un meccanismo fisico che prima o poi scopriremo.

    3. Dopo una settimana di dialogo, non Le e’ ancora chiara, Matteo, la differenza tra evoluzione e spiegazione (darwiniana o ID o strutturalistica) dell’evoluzione? Lo so che riconoscere di essere stati indottrinati per decenni e’ doloroso (io lo capisco bene, che sono stato un conformista darwinista di maniera per 50 anni), ma ad un certo momento occorre essere onesti e riconoscere che 1) il “caso” non e’ confutabile (lo afferma a voce alta perfino Boncinelli), 2) la selezione non e’ creatrice (ma solo distruttrice delle novità che non si adattano) e quindi 3) che il darwinismo non e’ una teoria scientifica, ma una parola con cui ci illudiamo di nascondere la nostra persistente ignoranza su come e’ nata ed evoluta la vita sulla Terra.

    • @Giorgio Masiero

      Le parole di Crick e Monod si riferiscono al fatto che l’evoluzione prendesse esattamente questa piega, non all’evoluzione di organismi complessi in sé.

      C’è da fare una precisazione di carattere metafisico.
      Molto spesso si sente dire che, se si riavvolgesse il tempo, un fenomeno caotico avrebbe esito completamente diverso. Questa frase è formulata con il presupposto filosofico dell’indeterminismo, diventato dominante dopo la nascita della MQ. Un determinista invece dovrebbe rileggere così la precedente affermazione: “se ci fosse un altro universo dove è tutto identico tranne per una piccolissima variazione delle condizioni iniziali nel fenomeno caotico in questione, allora esso avrebbe esito completamente diverso”.
      Secondo il determinista, era necessario e non contingente che in questo mondo tutto si sviluppasse esattamente com’è, secondo l’indeterminista è il contrario, e nessuna delle due posizioni è falsificabile.
      Non bisogna confondere questo dibattito filosofico con quello scientifico, ovvero se nell’evoluzione prevalga il caos o l’ordine, entrambe posizioni falsificabili, ed entrambe con esperimenti sia in favore che contro. Per quanto riguarda la mutazione, ovvero la prima parte dei tre fenomeni che insieme costituiscono l’evoluzione, non avevo mai sentito mettere in dubbio che sia casuale (ovvero conseguenza di fenomeni caotici, irripetibile riavvolgendo il tempo per gli indeterministi, irripetibile cambiando leggermente un valore iniziale per i deterministi), ma non si può escludere che si riuscirà a svelare sperimentalmente il contrario in futuro, siamo infatti nell’ambito delle teorie controllabili.

    • Il neodarwinismo fa previsioni controllabili, per quanto si possa parlare di previsioni nell’ambito di quella che è una ricostruzione storica.
      Ad esempio, la teoria darwiniana prevede che una famiglia di proteine tra loro simili discendano da un antenato comune, e sia possibile trovare questo antenato e tutte le forme intermedie attraverso la biologia evolutiva molecolare e la filogenesi. Sperimentalmente si verifica che tutte le proteine funzionano ed assumono funzioni via via più specifiche.
      http://www.lescienze.it/news/2012/12/12/news/lieviti_maltosio_evoluzione_geni_duplicazione-1416812/
      Eppure questo, a vostro parere, non si può chiamare esperimento ma speculazione..

      • (non è che sia una prova definitiva, tutt’altro, è solo un esempio fra tanti dei primi passi sperimentali che oggi è possibile compiere)

      • Una proteina comune all’origine di una serie di proteine tra loro simili è microevoluzione…
        Quand’è che si comincia a parlare dell’origine delle specie?
        E comunque lei continua a confondere il fatto dell’evoluzione con la sua spiegazione, piccole mutazioni su una famiglia di proteine simili possono essere neodarwiniane, ma il passaggio a un vera e propria nuova proteina?

        • Forse stiamo dimenticando che ad esempio tra uomo e scimpanzé non esiste una singola nuova proteina, sono solo varianti delle stesse.

          Quindi per parlare di macroevoluzione non bisogna aspettare che si formi da zero una nuova proteina, cosa che se osservata in tempi brevi confuterebbe il neodarwinismo.

          L’abiogenesi è ancora un altro discorso, in quel caso davvero si ritiene (secondo una delle varie ipotesi) che si formarono una manciata di piccole proteine, da cui tutte discendono, a partire da altri aggregati disordinati (ipotesi che la chimica non riesce ancora a trattare sperimentalmente, o forse non riuscirà mai).

        • Ripeto la domanda, non ci sono divergenze di vedute sulle modificazioni di una stessa proteina (anche se come dimostrato recentemente è difficilissimo indovinare sequenze funzionali): come avviene il passaggio ta una proteina e una completamente diversa?
          Il caso riportato dello scimpanzé e l’Uomo mi sembra controproducente per la sua causa, come si è sviluppata la capacità simbolica e di fonazione?

          Il neo-darwinismo non è soddisfacente come spiegazione dell’origine del linguaggio, ecco cosa dice una rivista ultradarwinista come MicroMega di questo mese:
          Negli ultimi 40 anni abbiamo assistito a un’esplosione di ricerche su questo tema e alla sensazione diffusa di aver compiuto sensibili progressi in merito. Noi siamo convinti invece che la ricchezza di idee proposte sia accompagnata da una scarsità di evidenze e, sostanzialmente, da nessuna spiegazione di come e perché si siano evolute le capacità di rappresentazione e quelle computazionali del nostro linguaggio”. Questa la posizione – molto netta – espressa da alcuni dei più autorevoli esperti di linguaggio e di evoluzione al mondo, a partire da Noam Chomsky e Ian Tattersall, per continuare con il grande genetista di Harvard Richard Lewontin, i linguisti Robert Berwick e Jeffrey Watumull, gli esperti di comunicazione animale Michael J. Ryan e Marc Hauser, lo studioso di apprendimento del linguaggio Charles Yang.

          • Come si siano sviluppate le capacità simboliche io non lo so, so solo che a rendere possibile ciò sono strutture molecolari molto simili a quelle delle scimmie antropomorfe. Non si trovano nell’uomo proteine o altre molecole completamente nuove, quella che si è maggiormente diversificata è la sequenza di RNA detta HAR1, con 18 mutazioni su 118 elementi.

            La nascita di proteine completamente diverse non è prevista dal neodarwinismo, tant’è che perfino tra i tre diversi domini tassonomici di procarioti, archea ed eucarioti si trovano sempre gli stessi moduli detti domini proteici, solo parzialmente modificati, riarrangiati, fusi insieme, differentemente specializzati, ma la maggior parte filogeneticamente riconducibili ad un unico antichissimo modulo, almeno secondo gli studiosi.

            http://www.lescienze.it/news/2009/03/12/news/il_big_bang_delle_proteine-575908/

            Possiamo discutere sulla fondatezza di questa ricostruzione, ma è per evidenziare cosa pretende la teoria neodarwinista e cosa invece non pretende, ovvero che in pochi milioni di anni una proteina si trasformi in un’altra completamente diversa. Al contrario, molto spesso si osservano proteine molto simili svolgere funzioni assai diverse.

          • Matteo scrive:
            “La nascita di proteine completamente diverse non è prevista dal neodarwinismo, tant’è che perfino tra i tre diversi domini tassonomici di procarioti, archea ed eucarioti si trovano sempre gli stessi moduli detti domini proteici, solo parzialmente modificati, riarrangiati, fusi insieme, differentemente specializzati, ma la maggior parte filogeneticamente riconducibili ad un unico antichissimo modulo, almeno secondo gli studiosi.

            Possiamo discutere sulla fondatezza di questa ricostruzione, ma è per evidenziare cosa pretende la teoria neodarwinista e cosa invece non pretende, ovvero che in pochi milioni di anni una proteina si trasformi in un’altra completamente diversa. Al contrario, molto spesso si osservano proteine molto simili svolgere funzioni assai diverse.”

            Benissimo, finalmente siamo arrivati ad una conclusione condivisa.
            Il neodarwinismo spiega la microevoluzione (modificazioni di una stessa proteina) e non la comparsa di nuove proteine, quindi la macroevoluzione in generale.
            Il neodarwinismo non spiega l’evoluzione!

            Riguardo le differenze tra Uomo e scimmia mi sembra che comunque si tratti di un caso che non aiuta a capire la questione, parliamo delle 100.000 proteine umane, sono tutte variazioni sul tema di una sola?

      • Giorgio Masiero on

        Lei continua a non capire una cosa, Matteo: la differenza tra evoluzione e spiegazione dell’evoluzione. La scienza non e’ mera registrazione dei fatti, ma SPIEGAZIONE della loro catena causale. Ciò che dice sulle proteine e’ (micro-)evoluzione, ma il darwinismo non spiega COME il fenomeno della produzione di decine di migliaia di proteine diverse sia avvenuto. Ognuna di queste comparse non e’ caotica, per cui si possa ricorrere alla contingenza della fisica classica ottocentesca, ma un evento QUANTISTICO PUNTUALIZZATO SUI LEGAMI FOSFODIESTERICI del DNA.
        A questo punto, avendoGlielo da parte mia detto 3-4 volte, chiudo il dialogo. Buona notte.

        PS. Su quanto Lei ha scritto a proposito di Crick, Monod, ecc., preferisco tacere, perché e’ la terza volta (dopo la funzione di Chaitin e l’articolo di Pikaia) che Lei porta argomenti a sproposito, forse pensando di parlare con degli scolaretti. Lasci stare la metafisica, non e’ argomento per Lei.

      • @Matteo,

        Una previsione scientifica è altro: date le condizioni indiziali X, per le leggi Y si avranno gli esiti Z (almeno statisticamente e con buona approssimazione).

        Pre-vedere nel senso di vedere prima (non nel senso di “contemplare un’ipotesi come possibile”: es. fare ciò non è previsto dalla legge, che è l’accezione che usa lei nel suo esempio).

        Forse sarebbe meglio usare il termine “predittivo” a quel punto non si può più giocare sulle ambiguità dei termini: il neodarwinismo non predice niente.

  7. “Matteo scrive:
    13 luglio 2014 alle 15:42 (Modifica)
    Certo, qui si parla di studi sulla microevoluzione, ma non si possono ricondurre semplicemente alle leggi di Mendel, bensì necessitano proprio dell’approccio integrato della sintesi moderna, a meno di postulare la non introduzione di nuove varianti dei geni, ma questa ipotesi può nutrire false speranze e portare a credere che sia possibile progettare un pesticida con efficacia definitiva su tutti gli insetti della specie interessata.
    Sul campo si è osservato che la risposta della popolazione di insetti è quella di evolvere sempre una forma di resistenza ai nuovi pesticidi, l’unica cosa su cui si può avere un controllo è la rapidità con cui questo avviene. Sequenziando il DNA si è visto che ci sono effettivamente delle mutazioni nei geni coinvolti: difficile credere che tutte le varianti alleliche, che a seconda della pressione selettiva diventano dominanti, fossero già preesistenti (ovvero, dopo la mutazione casuale, abbiano finito per fissarsi in qualche sottopopolazione per puro caso, prima ancora che i vari pesticidi fossero inventati, solo se la mutazione casuale avviene durante il processo selettivo allora viene selezionata positivamente).”

    Matteo, questo suo intervento mostra che lei vede la biologia evoluzionistica che vorrebbe e non quella che è, gli esperimenti che vorrebbe e non quello che sono.
    Le riconosco l’attenuante di essere fuorviato dalle parole stesse usate da chi diffonde le ricerche e fa una confusione che temo sia volontaria.
    Ecco il pezzo della ricerca da LEI segnalata che smentisce le sue affermazioni: gli alleli erano preesistenti, infatti sono definiti rari, non assenti, e sul termine “evoluzione” non sono tutti d’accordo:

  8. Giorgio Masiero on

    Per la precisione, Enzo, non è tanto Micromega a “dirlo”, ma 7 tra i maggiori scienziati internazionali del settore. Micromega lo “riferisce”, con maggiore onestà di certi Portali dell’evoluzione…

      • Giorgio Masiero on

        E spero, Enzo, di poter leggere presto anche su CS questo “manifesto” dei 7 contro la falsa scienza e a favore della “specificità” umana.
        Tra l’altro, Tattersal vi ripete quel che tu avevi benissimo capito da un suo discorso in Italia, sollevando l’immediato scandalo dei sacerdoti dell’ortodossia darwiniana, che ti accusarono di aver distorto il pensiero di Tattersal. Ricordi?

  9. Buona sera,
    leggo da poco questo sito, veramente interessante! A riguardo di questi argomenti le volevo segnalare l’opionione di un “tale” Ludwig von Bertalanffy ma vedo che lei e’ un biologo e anzi lo ha gia’ citato.
    Le volevo comunque ricordare la sua opinione, cioe’ che la definizione di “selezione naturale” e’ come minimo una tautologia.
    Incredibile come possano passare 2 secoli prima di arrivare ad una verita’… tautologica.
    Caro mio, io appoggio Feyerabend, non esiste la scienza, ognuno faccia come vuole.
    Gia’, ma aggiungo io, nessuno si vesta di camici porporati e salga sugli Ziqqurat… cosa ancora molto in voga.
    Buona serata, spero di poter intervenire altre volte con maggiori contributi.
    Fabio

    • Giorgio Masiero on

      Penso, Fabio, che von Bertlanffy avesse perfettamente ragione quando ha chiamato una tautologia la selezione naturale. Io ho denominato negli stessi identici termini la selezione naturale nel primo articolo di 2 anni fa, che ho scritto per la rubrica Tavola Alta di CS (http://www.enzopennetta.it/2012/09/il-dovere-di-cercare-una-soluzione-scientifica-per-lorigine-delle-specie/ ) e nell’ultimo (http://www.enzopennetta.it/2014/05/la-vita-e-fisica-parte-iii/ ).
      Quei darwinisti che non hanno portato il cervello all’ammasso, avranno i loro buoni motivi pratici per (affermare di) credere nella selezione naturale come fattore creativo (anziché solo distruttivo).

      Dissento invece dalla Sua interpretazione radicale sul significato di scienza empirica in Feyerabend, che è più valido per la tecnica, secondo me. Che cos’è la scienza empirica? Il metodo galileiano. Ma speriamo di risentirci ancora.

    • Di Feyerabend ho letto “Contro il metodo”, una lettura interessantissima.
      In pratica sostiene che non esiste un vero e proprio metodo per arrivare ad un’ipotesi, lo stesso Galileo nella disputa sul sistema copernicano si affidò più all’intuito e alla ‘propaganda’ che lo stesso Galileo mette in atto con i suoi scritti, sorvolando sulle cose che non si sanno spiegare e concentrandosi sui punti più favorevoli, in definitiva una teoria si afferma e si consolida più su aspetti sociali e di comunicazione che sulle osservazioni e la razionalità.

      Questo è un riassunto necessariamente parziale, ma volevo rendere gli aspetti che fanno riflettere su certe dinamiche dell’affermazione delle teorie scientifiche.